Mutagenetix > Incidental Mutation

Incidental Mutation 'R4564:Trpm6'

343274

Institutional Source

Beutler Lab

Gene Symbol

Trpm6

Ensembl Gene

ENSMUSG00000024727

Gene Name

transient receptor potential cation channel, subfamily M, member 6

Synonyms

CHAK2

MMRRC Submission

041789-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4564 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

18749983-18892510 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 18832597 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 1119 (L1119P)

Ref Sequence

ENSEMBL: ENSMUSP00000037443 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040489]

AlphaFold

Q8CIR4

Predicted Effect

possibly damaging
Transcript: ENSMUST00000040489
AA Change: L1119P

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000037443
Gene: ENSMUSG00000024727
AA Change: L1119P

Domain	Start	End	E-Value	Type
Blast:ANK	430	459	4e-8	BLAST
low complexity region	580	604	N/A	INTRINSIC
transmembrane domain	749	766	N/A	INTRINSIC
Pfam:Ion_trans	847	1087	2.8e-13	PFAM
low complexity region	1113	1126	N/A	INTRINSIC
low complexity region	1136	1154	N/A	INTRINSIC
Pfam:TRPM_tetra	1176	1231	7.5e-27	PFAM
low complexity region	1320	1331	N/A	INTRINSIC
low complexity region	1578	1596	N/A	INTRINSIC
Blast:Alpha_kinase	1618	1673	9e-11	BLAST
low complexity region	1682	1695	N/A	INTRINSIC
Alpha_kinase	1761	1978	1e-84	SMART

Meta Mutation Damage Score

0.3539

Coding Region Coverage

1x: 99.3%
3x: 98.5%
10x: 97.0%
20x: 94.6%

Validation Efficiency

97% (58/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is predominantly expressed in the kidney and colon, and encodes a protein containing an ion channel domain and a protein kinase domain. It is crucial for magnesium homeostasis, and plays an essential role in epithelial magnesium transport and in the active magnesium absorption in the gut and kidney. Mutations in this gene are associated with hypomagnesemia with secondary hypocalcemia. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic and postnatal lethality with exencephaly, spina bifida occulta, and abnormal brain and facial development. Mice heterozygous for a knock-out allele exhibit some premature death and decreased serummagnesium. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Atad3a	C	T	4: 155,747,309		probably null	Het
Bach2	T	G	4: 32,563,338	S602A	probably damaging	Het
Ccl19	G	T	4: 42,756,295	S12R	probably damaging	Het
Cfap54	T	C	10: 92,839,540		probably benign	Het
Cndp1	T	A	18: 84,622,286	I265F	probably damaging	Het
Cnot3	G	A	7: 3,653,258	R181H	probably damaging	Het
Dicer1	T	A	12: 104,704,751	K1011*	probably null	Het
Dip2b	G	A	15: 100,157,258	W99*	probably null	Het
Fam129c	T	C	8: 71,605,060		probably benign	Het
Fpr-rs6	A	T	17: 20,182,906	Y64*	probably null	Het
Fubp1	C	A	3: 152,222,936	Y480*	probably null	Het
Gfra1	T	C	19: 58,239,250		probably null	Het
Gm10770	T	C	2: 150,178,911	T229A	probably benign	Het
Gm826	A	C	2: 160,311,993		probably benign	Het
Gpd2	G	A	2: 57,307,083	V217I	possibly damaging	Het
Hectd4	T	C	5: 121,350,431	I3595T	probably benign	Het
Lmln	A	G	16: 33,109,856	E561G	probably benign	Het
Lrrc71	T	A	3: 87,745,408		probably benign	Het
Man2a2	T	A	7: 80,368,838	Y91F	probably benign	Het
Map4k4	A	G	1: 39,988,975	T319A	probably damaging	Het
Mcm6	G	T	1: 128,343,459	H474Q	probably damaging	Het
Mn1	C	G	5: 111,420,667	N834K	possibly damaging	Het
Mslnl	G	A	17: 25,742,934	V128M	probably damaging	Het
Npas2	A	G	1: 39,287,566	D44G	probably damaging	Het
Npc1	C	T	18: 12,191,732	G1235R	probably damaging	Het
Olfml2a	C	T	2: 38,960,294	T674I	probably benign	Het
Olfr1311	A	G	2: 112,021,767	L29P	possibly damaging	Het
Plxnb1	C	T	9: 109,113,420	A1779V	probably benign	Het
Ppil3	T	A	1: 58,431,322	D123V	probably damaging	Het
Prr23a3	A	G	9: 98,865,137	E48G	probably damaging	Het
Prr5l	T	C	2: 101,746,749	E110G	probably damaging	Het
Ptgir	A	G	7: 16,906,869	M29V	possibly damaging	Het
R3hdm1	C	T	1: 128,221,659	T839M	probably benign	Het
Rasgrf2	G	A	13: 91,885,654	Q544*	probably null	Het
Riok3	C	A	18: 12,148,879	R302S	probably damaging	Het
Rnf145	A	G	11: 44,548,808	K144E	probably benign	Het
Sin3b	A	C	8: 72,753,581	T904P	probably damaging	Het
Skint4	C	T	4: 112,119,869	T152M	probably damaging	Het
Slc22a2	A	G	17: 12,610,056	I350V	probably benign	Het
Slc6a11	G	T	6: 114,131,362	G29V	probably benign	Het
Speg	A	C	1: 75,391,834	H676P	probably damaging	Het
St6gal2	T	A	17: 55,482,647	H227Q	probably damaging	Het
Strn3	A	G	12: 51,633,621	S399P	probably benign	Het
Tbc1d1	A	G	5: 64,173,484	E2G	probably damaging	Het
Tecpr2	T	A	12: 110,954,785	M1264K	probably benign	Het
Tmem8	A	G	17: 26,117,863	R252G	possibly damaging	Het
Upf2	A	C	2: 6,027,312	T890P	unknown	Het
Upk1b	T	A	16: 38,780,107	K170N	probably benign	Het
Vmn1r78	A	T	7: 12,152,558	Y32F	probably damaging	Het
Vps11	A	G	9: 44,361,597	F12S	probably damaging	Het
Zfp318	T	A	17: 46,412,815	C1915S	possibly damaging	Het
Zfp346	A	C	13: 55,113,707	R103S	probably damaging	Het

Other mutations in Trpm6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00540:Trpm6	APN	19	18783908	splice site	probably benign
IGL00862:Trpm6	APN	19	18827528	missense	probably damaging	1.00
IGL01348:Trpm6	APN	19	18877651	missense	probably damaging	1.00
IGL01400:Trpm6	APN	19	18825794	nonsense	probably null
IGL01451:Trpm6	APN	19	18809569	missense	probably damaging	1.00
IGL01508:Trpm6	APN	19	18796530	nonsense	probably null
IGL01995:Trpm6	APN	19	18830327	splice site	probably benign
IGL02092:Trpm6	APN	19	18772331	missense	possibly damaging	0.59
IGL02152:Trpm6	APN	19	18832539	missense	possibly damaging	0.93
IGL02294:Trpm6	APN	19	18854063	missense	probably benign
IGL02329:Trpm6	APN	19	18854217	missense	probably benign	0.17
IGL02366:Trpm6	APN	19	18778510	splice site	probably benign
IGL02402:Trpm6	APN	19	18786756	missense	probably benign	0.18
IGL02457:Trpm6	APN	19	18825791	missense	probably damaging	1.00
IGL02457:Trpm6	APN	19	18827398	nonsense	probably null
IGL02684:Trpm6	APN	19	18802207	splice site	probably benign
IGL02705:Trpm6	APN	19	18776733	critical splice donor site	probably null
IGL02728:Trpm6	APN	19	18809652	missense	possibly damaging	0.71
IGL02742:Trpm6	APN	19	18830012	splice site	probably benign
IGL02818:Trpm6	APN	19	18866257	missense	probably benign	0.04
IGL02836:Trpm6	APN	19	18813482	missense	probably damaging	1.00
IGL03119:Trpm6	APN	19	18838017	nonsense	probably null
IGL03193:Trpm6	APN	19	18825872	missense	possibly damaging	0.94
IGL03227:Trpm6	APN	19	18819119	missense	probably benign	0.01
IGL03227:Trpm6	APN	19	18786779	missense	probably benign	0.12
IGL03231:Trpm6	APN	19	18819181	missense	probably benign
IGL03245:Trpm6	APN	19	18877701	missense	probably damaging	1.00
IGL03328:Trpm6	APN	19	18838082	missense	possibly damaging	0.94
IGL03341:Trpm6	APN	19	18813486	missense	probably benign
P0043:Trpm6	UTSW	19	18877765	missense	probably damaging	1.00
PIT4260001:Trpm6	UTSW	19	18825802	missense	possibly damaging	0.48
R0057:Trpm6	UTSW	19	18786755	missense	probably benign	0.05
R0115:Trpm6	UTSW	19	18829952	missense	probably damaging	0.98
R0119:Trpm6	UTSW	19	18832593	missense	probably benign	0.05
R0140:Trpm6	UTSW	19	18819194	splice site	probably null
R0267:Trpm6	UTSW	19	18823378	missense	probably benign
R0350:Trpm6	UTSW	19	18883957	splice site	probably null
R0373:Trpm6	UTSW	19	18853587	missense	probably benign	0.15
R0393:Trpm6	UTSW	19	18778644	missense	probably damaging	0.99
R0416:Trpm6	UTSW	19	18783025	splice site	probably benign
R0505:Trpm6	UTSW	19	18873902	splice site	probably benign
R0526:Trpm6	UTSW	19	18792876	missense	probably damaging	0.97
R0607:Trpm6	UTSW	19	18872221	missense	probably benign	0.00
R0609:Trpm6	UTSW	19	18825862	missense	probably damaging	0.97
R0714:Trpm6	UTSW	19	18838087	missense	possibly damaging	0.90
R1215:Trpm6	UTSW	19	18796498	missense	probably damaging	1.00
R1474:Trpm6	UTSW	19	18796495	missense	probably benign	0.28
R1512:Trpm6	UTSW	19	18875931	missense	probably benign
R1558:Trpm6	UTSW	19	18786828	missense	probably benign	0.04
R1597:Trpm6	UTSW	19	18827524	missense	probably damaging	0.98
R1618:Trpm6	UTSW	19	18877631	missense	possibly damaging	0.88
R1779:Trpm6	UTSW	19	18856217	missense	probably damaging	1.00
R1796:Trpm6	UTSW	19	18827567	missense	possibly damaging	0.90
R1799:Trpm6	UTSW	19	18891999	splice site	probably null
R1840:Trpm6	UTSW	19	18866267	missense	probably benign	0.21
R1991:Trpm6	UTSW	19	18796284	missense	probably benign	0.00
R2030:Trpm6	UTSW	19	18854265	missense	probably benign
R2073:Trpm6	UTSW	19	18876042	missense	probably damaging	1.00
R2074:Trpm6	UTSW	19	18877739	missense	probably damaging	1.00
R2096:Trpm6	UTSW	19	18825752	missense	probably damaging	0.97
R2103:Trpm6	UTSW	19	18796284	missense	probably benign	0.00
R2106:Trpm6	UTSW	19	18813350	missense	possibly damaging	0.95
R2117:Trpm6	UTSW	19	18829952	missense	probably damaging	0.98
R2850:Trpm6	UTSW	19	18792090	missense	possibly damaging	0.68
R3125:Trpm6	UTSW	19	18854431	missense	probably benign	0.05
R3719:Trpm6	UTSW	19	18772393	nonsense	probably null
R3779:Trpm6	UTSW	19	18876039	missense	possibly damaging	0.80
R4115:Trpm6	UTSW	19	18832557	missense	probably damaging	1.00
R4367:Trpm6	UTSW	19	18827525	missense	probably damaging	0.99
R4523:Trpm6	UTSW	19	18796500	missense	probably damaging	1.00
R4546:Trpm6	UTSW	19	18832477	missense	probably damaging	1.00
R4565:Trpm6	UTSW	19	18825872	missense	probably damaging	1.00
R4697:Trpm6	UTSW	19	18853791	missense	probably benign	0.01
R4714:Trpm6	UTSW	19	18854200	missense	possibly damaging	0.93
R4750:Trpm6	UTSW	19	18876064	missense	probably damaging	0.99
R4771:Trpm6	UTSW	19	18813493	missense	probably damaging	0.97
R4791:Trpm6	UTSW	19	18867981	missense	probably benign	0.00
R4814:Trpm6	UTSW	19	18862212	missense	probably benign	0.11
R5028:Trpm6	UTSW	19	18786760	missense	probably damaging	1.00
R5237:Trpm6	UTSW	19	18813464	missense	probably damaging	1.00
R5615:Trpm6	UTSW	19	18829933	missense	probably damaging	0.96
R5642:Trpm6	UTSW	19	18830207	missense	probably damaging	1.00
R5645:Trpm6	UTSW	19	18853604	missense	probably damaging	1.00
R5726:Trpm6	UTSW	19	18853617	missense	probably damaging	1.00
R5832:Trpm6	UTSW	19	18786819	missense	possibly damaging	0.66
R5843:Trpm6	UTSW	19	18856175	missense	probably benign	0.04
R5955:Trpm6	UTSW	19	18892019	missense	possibly damaging	0.75
R6101:Trpm6	UTSW	19	18853748	nonsense	probably null
R6105:Trpm6	UTSW	19	18853748	nonsense	probably null
R6211:Trpm6	UTSW	19	18783128	missense	probably damaging	1.00
R6228:Trpm6	UTSW	19	18854291	missense	probably damaging	1.00
R6263:Trpm6	UTSW	19	18854108	missense	possibly damaging	0.94
R6453:Trpm6	UTSW	19	18829990	missense	probably damaging	1.00
R6562:Trpm6	UTSW	19	18838042	missense	probably damaging	1.00
R6624:Trpm6	UTSW	19	18796439	critical splice acceptor site	probably null
R6624:Trpm6	UTSW	19	18889020	missense	probably damaging	1.00
R6729:Trpm6	UTSW	19	18830297	missense	probably damaging	1.00
R6765:Trpm6	UTSW	19	18877765	missense	probably damaging	1.00
R6976:Trpm6	UTSW	19	18783163	missense	probably benign
R7103:Trpm6	UTSW	19	18813547	missense	possibly damaging	0.87
R7126:Trpm6	UTSW	19	18854033	nonsense	probably null
R7128:Trpm6	UTSW	19	18811773	missense	possibly damaging	0.92
R7157:Trpm6	UTSW	19	18838098	missense	possibly damaging	0.91
R7212:Trpm6	UTSW	19	18853791	missense	probably benign	0.01
R7263:Trpm6	UTSW	19	18876786	missense	probably damaging	1.00
R7268:Trpm6	UTSW	19	18778585	missense	probably benign	0.13
R7305:Trpm6	UTSW	19	18876091	missense	probably benign	0.30
R7498:Trpm6	UTSW	19	18876120	missense	probably damaging	1.00
R7558:Trpm6	UTSW	19	18778665	missense	probably damaging	0.96
R7590:Trpm6	UTSW	19	18832581	missense	probably benign	0.31
R7646:Trpm6	UTSW	19	18867961	missense	probably benign	0.10
R7650:Trpm6	UTSW	19	18876013	missense	possibly damaging	0.70
R7727:Trpm6	UTSW	19	18854249	missense	probably damaging	0.97
R7743:Trpm6	UTSW	19	18827408	missense	probably benign	0.03
R7747:Trpm6	UTSW	19	18750045	splice site	probably null
R7807:Trpm6	UTSW	19	18829856	missense	probably benign	0.11
R7870:Trpm6	UTSW	19	18815241	missense	probably benign	0.01
R7891:Trpm6	UTSW	19	18776710	missense	probably benign	0.01
R7955:Trpm6	UTSW	19	18854290	missense	probably benign	0.01
R7965:Trpm6	UTSW	19	18876110	missense	probably damaging	1.00
R7967:Trpm6	UTSW	19	18778659	missense	probably damaging	0.99
R7992:Trpm6	UTSW	19	18815350	missense	probably damaging	1.00
R8035:Trpm6	UTSW	19	18792862	missense	probably damaging	0.97
R8108:Trpm6	UTSW	19	18811790	missense	probably damaging	1.00
R8268:Trpm6	UTSW	19	18873861	missense	possibly damaging	0.85
R8411:Trpm6	UTSW	19	18853968	missense	probably benign	0.39
R8413:Trpm6	UTSW	19	18832485	missense	probably benign	0.00
R8534:Trpm6	UTSW	19	18892095	missense	probably benign	0.00
R8932:Trpm6	UTSW	19	18838002	missense	possibly damaging	0.87
R8990:Trpm6	UTSW	19	18815435	missense	probably damaging	1.00
R9403:Trpm6	UTSW	19	18832652	missense	possibly damaging	0.84
R9446:Trpm6	UTSW	19	18838098	missense	possibly damaging	0.91
R9463:Trpm6	UTSW	19	18783900	critical splice donor site	probably null
R9485:Trpm6	UTSW	19	18778614	missense	probably benign	0.06
R9536:Trpm6	UTSW	19	18786759	missense	probably damaging	1.00
R9549:Trpm6	UTSW	19	18876030	nonsense	probably null
R9564:Trpm6	UTSW	19	18873876	missense	possibly damaging	0.92
R9626:Trpm6	UTSW	19	18813482	missense	probably damaging	1.00
R9655:Trpm6	UTSW	19	18892102	missense	probably benign
R9721:Trpm6	UTSW	19	18829972	missense	probably benign	0.12
R9742:Trpm6	UTSW	19	18823402	missense	probably benign	0.09

Predicted Primers

PCR Primer
(F):5'- GGTCTAACTGTCACATTTTGGATCC -3'
(R):5'- TCTCAGGACCTTCATGTGGG -3'

Sequencing Primer
(F):5'- TGGATCCCATATTAAAATGTTCTCTC -3'
(R):5'- GGGACCTCACTAGAATTGCCAGTC -3'

Posted On

2015-09-24