Incidental Mutation 'R4565:Dhx35'
ID343278
Institutional Source Beutler Lab
Gene Symbol Dhx35
Ensembl Gene ENSMUSG00000027655
Gene NameDEAH (Asp-Glu-Ala-His) box polypeptide 35
Synonyms1200009D07Rik, Ddx35
MMRRC Submission 041790-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4565 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location158794807-158858214 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 158849535 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 646 (A646E)
Ref Sequence ENSEMBL: ENSMUSP00000105104 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029186] [ENSMUST00000109478]
Predicted Effect probably benign
Transcript: ENSMUST00000029186
SMART Domains Protein: ENSMUSP00000029186
Gene: ENSMUSG00000027655

DomainStartEndE-ValueType
DEXDc 55 248 1.17e-18 SMART
HELICc 299 398 8.76e-18 SMART
HA2 458 549 1.49e-27 SMART
Pfam:OB_NTP_bind 628 660 2.7e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109478
AA Change: A646E

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000105104
Gene: ENSMUSG00000027655
AA Change: A646E

DomainStartEndE-ValueType
DEXDc 55 248 1.17e-18 SMART
HELICc 299 398 8.76e-18 SMART
HA2 458 549 1.49e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143195
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145692
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146797
Meta Mutation Damage Score 0.0749 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of the DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. The function of this gene product which is a member of this family, has not been determined. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jun 2010]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930011G23Rik T C 5: 99,227,947 probably benign Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Afg3l1 A T 8: 123,501,869 K725* probably null Het
Alkbh1 T C 12: 87,431,466 D225G probably damaging Het
Anxa2 A T 9: 69,489,737 K241M probably damaging Het
Bptf G A 11: 107,073,010 T1786M probably damaging Het
Cnst A G 1: 179,604,549 E208G probably damaging Het
Dcdc2b T C 4: 129,610,985 T118A probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dnhd1 T A 7: 105,651,956 D173E possibly damaging Het
Dpy19l1 A T 9: 24,432,388 L487Q probably null Het
Gtse1 T G 15: 85,875,184 V631G probably damaging Het
Haspin G A 11: 73,137,619 L215F probably benign Het
Herc2 T C 7: 56,153,838 V2207A possibly damaging Het
Jph1 A G 1: 17,004,202 Y531H possibly damaging Het
Limk2 A G 11: 3,348,634 I261T probably damaging Het
Oas3 A G 5: 120,771,039 F281L probably damaging Het
Olfr19 C A 16: 16,673,693 G96V probably damaging Het
Olfr447 A T 6: 42,911,538 Q5L probably benign Het
Pcdhb17 A G 18: 37,486,470 T438A probably benign Het
Pfdn5 T C 15: 102,326,785 probably benign Het
Rab11fip3 A G 17: 26,068,706 C158R possibly damaging Het
Rbmxl1 G A 8: 78,506,010 P235S probably benign Het
Slc9b1 G T 3: 135,382,717 V280F probably damaging Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Trpm3 T C 19: 22,987,869 I1576T probably benign Het
Trpm6 T A 19: 18,825,872 V893D probably damaging Het
Ttc13 A T 8: 124,682,087 N583K probably damaging Het
Zfp618 T C 4: 63,121,351 C396R probably damaging Het
Other mutations in Dhx35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Dhx35 APN 2 158827916 missense probably damaging 1.00
IGL01942:Dhx35 APN 2 158831864 missense probably damaging 1.00
IGL02899:Dhx35 APN 2 158801450 missense probably damaging 1.00
IGL02927:Dhx35 APN 2 158820416 missense probably damaging 1.00
IGL03224:Dhx35 APN 2 158857132 utr 3 prime probably benign
R0112:Dhx35 UTSW 2 158840620 missense probably damaging 0.99
R0200:Dhx35 UTSW 2 158829623 missense probably benign
R0609:Dhx35 UTSW 2 158817415 missense possibly damaging 0.62
R0714:Dhx35 UTSW 2 158844183 missense probably benign
R0884:Dhx35 UTSW 2 158831711 missense probably damaging 0.97
R1775:Dhx35 UTSW 2 158806437 missense probably damaging 1.00
R1912:Dhx35 UTSW 2 158842307 missense probably damaging 0.96
R2136:Dhx35 UTSW 2 158831861 missense probably damaging 1.00
R4094:Dhx35 UTSW 2 158842356 missense probably damaging 1.00
R4364:Dhx35 UTSW 2 158842352 nonsense probably null
R4421:Dhx35 UTSW 2 158806401 missense probably damaging 1.00
R5517:Dhx35 UTSW 2 158834912 missense probably damaging 1.00
R5732:Dhx35 UTSW 2 158831785 missense probably damaging 0.99
R5979:Dhx35 UTSW 2 158842869 missense probably benign 0.29
R6054:Dhx35 UTSW 2 158818299 missense probably benign 0.00
R6405:Dhx35 UTSW 2 158794919 missense probably damaging 1.00
R6452:Dhx35 UTSW 2 158831687 missense probably damaging 1.00
R6519:Dhx35 UTSW 2 158831710 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TCGGTCTTCATACATTCGGG -3'
(R):5'- TGACAAGAGTACAAACCCTGGC -3'

Sequencing Primer
(F):5'- CTTCATACATTCGGGGGAGGAG -3'
(R):5'- CCAACGTCAACAGCGTGGAG -3'
Posted On2015-09-24