Incidental Mutation 'R0058:Golga3'
ID34328
Institutional Source Beutler Lab
Gene Symbol Golga3
Ensembl Gene ENSMUSG00000029502
Gene Namegolgi autoantigen, golgin subfamily a, 3
Synonymsrepro27, G1-499-14, Mea-2, 5430416E01Rik, Mea2
MMRRC Submission 038352-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0058 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location110176701-110226470 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 110202777 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 766 (F766Y)
Ref Sequence ENSEMBL: ENSMUSP00000031477 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031477] [ENSMUST00000112512]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031477
AA Change: F766Y

PolyPhen 2 Score 0.852 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000031477
Gene: ENSMUSG00000029502
AA Change: F766Y

DomainStartEndE-ValueType
internal_repeat_1 24 49 7.67e-5 PROSPERO
internal_repeat_1 91 116 7.67e-5 PROSPERO
low complexity region 232 245 N/A INTRINSIC
low complexity region 269 288 N/A INTRINSIC
low complexity region 312 321 N/A INTRINSIC
low complexity region 362 375 N/A INTRINSIC
low complexity region 422 441 N/A INTRINSIC
internal_repeat_2 444 484 7.67e-5 PROSPERO
low complexity region 534 548 N/A INTRINSIC
internal_repeat_2 587 624 7.67e-5 PROSPERO
coiled coil region 656 1379 N/A INTRINSIC
coiled coil region 1417 1453 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112512
AA Change: F726Y

PolyPhen 2 Score 0.600 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000108131
Gene: ENSMUSG00000029502
AA Change: F726Y

DomainStartEndE-ValueType
internal_repeat_2 3 24 9.29e-5 PROSPERO
low complexity region 192 205 N/A INTRINSIC
low complexity region 229 248 N/A INTRINSIC
low complexity region 272 281 N/A INTRINSIC
low complexity region 322 335 N/A INTRINSIC
low complexity region 382 401 N/A INTRINSIC
internal_repeat_1 404 444 4.91e-5 PROSPERO
low complexity region 494 508 N/A INTRINSIC
internal_repeat_1 547 584 4.91e-5 PROSPERO
low complexity region 705 717 N/A INTRINSIC
low complexity region 792 809 N/A INTRINSIC
low complexity region 1105 1117 N/A INTRINSIC
low complexity region 1220 1228 N/A INTRINSIC
low complexity region 1312 1330 N/A INTRINSIC
internal_repeat_2 1333 1359 9.29e-5 PROSPERO
coiled coil region 1377 1413 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199123
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi apparatus, which participates in glycosylation and transport of proteins and lipids in the secretory pathway, consists of a series of stacked cisternae (flattened membrane sacs). Interactions between the Golgi and microtubules are thought to be important for the reorganization of the Golgi after it fragments during mitosis. This gene encodes a member of the golgin family of proteins which are localized to the Golgi. Its encoded protein has been postulated to play a role in nuclear transport and Golgi apparatus localization. Several alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Feb 2010]
PHENOTYPE: Males homozygous for a hypomorphic transgenic insertional mutation exhibit impaired spermatogenesis involving loss of pachytene spermatocytes and are usually sterile. Male mice homozygous for an ENU-induced mutation exhibit infertility with low sperm concentration, poor motility and abnormal shape. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ache T G 5: 137,290,842 V270G probably damaging Het
Acss1 A T 2: 150,628,539 W394R probably damaging Het
Adgrv1 A G 13: 81,182,672 V6088A possibly damaging Het
Ankrd36 A G 11: 5,630,691 probably benign Het
Anxa1 A T 19: 20,383,777 Y84N probably damaging Het
Arnt2 G A 7: 84,347,530 R63C probably damaging Het
Avpr1b A G 1: 131,599,786 T16A probably benign Het
Bpifb1 G A 2: 154,206,540 R165H possibly damaging Het
Cables1 A G 18: 11,923,413 E316G possibly damaging Het
Cadm1 A T 9: 47,850,331 I427L probably damaging Het
Ccdc97 T C 7: 25,715,980 D86G probably benign Het
Cgnl1 C A 9: 71,641,397 D1081Y probably damaging Het
Cgnl1 T A 9: 71,724,840 R410W probably damaging Het
Cntnap4 G A 8: 112,785,784 E593K probably damaging Het
Dazap1 T C 10: 80,261,581 probably benign Het
Dip2b A G 15: 100,215,240 E1512G probably benign Het
Dock1 G A 7: 135,108,761 V1171M possibly damaging Het
Dock5 A T 14: 67,781,036 F1230Y probably benign Het
Dym G A 18: 75,043,172 E15K possibly damaging Het
Ednra C A 8: 77,667,322 probably null Het
Faf1 A G 4: 109,736,624 Q133R probably benign Het
Fbxw28 A G 9: 109,328,211 I323T probably benign Het
Fcer2a T C 8: 3,688,111 probably benign Het
Fmo2 A T 1: 162,886,324 S204R probably benign Het
Frmd4b A G 6: 97,423,499 V63A probably damaging Het
Fzd8 G A 18: 9,213,985 A356T possibly damaging Het
Ghitm A G 14: 37,131,592 L97P probably damaging Het
Gins4 A G 8: 23,229,510 probably benign Het
Hapln1 T C 13: 89,607,878 I267T probably benign Het
Helz A T 11: 107,672,558 probably benign Het
Herc2 T C 7: 56,170,483 V2851A possibly damaging Het
Igkv8-18 G A 6: 70,356,121 probably benign Het
Igll1 A T 16: 16,863,876 V5E probably benign Het
Irx3 T C 8: 91,800,540 T179A possibly damaging Het
Kif16b A G 2: 142,857,305 probably null Het
Limk1 A T 5: 134,659,871 W507R probably damaging Het
Marf1 C T 16: 14,142,534 A549T probably damaging Het
Mtif3 C A 5: 146,956,921 V159F probably benign Het
Myh6 C T 14: 54,963,404 R169Q probably damaging Het
Ncoa7 T A 10: 30,647,541 D887V probably damaging Het
Obox7 C T 7: 14,664,388 P76S probably benign Het
Olfr1335 A G 4: 118,809,480 M128T probably benign Het
Olfr323 A T 11: 58,625,668 I126N probably damaging Het
Pitpnm2 G A 5: 124,124,030 A862V probably damaging Het
Pkd1 G C 17: 24,564,703 A162P probably benign Het
Plce1 A G 19: 38,525,184 D309G possibly damaging Het
Plk4 T C 3: 40,805,872 V401A probably benign Het
Prdx3 T C 19: 60,874,512 probably benign Het
Prrc2c C T 1: 162,698,884 V253I unknown Het
Ranbp2 T A 10: 58,480,531 S2358T probably damaging Het
Setd2 T A 9: 110,594,426 V2183E probably damaging Het
Sgsm1 T A 5: 113,285,087 S232C probably damaging Het
Skint6 A T 4: 113,046,815 probably benign Het
Slc15a2 A G 16: 36,754,547 I531T probably benign Het
Slc36a1 C T 11: 55,221,994 probably benign Het
Sorbs2 T A 8: 45,785,254 probably null Het
Sorbs2 C A 8: 45,796,263 D831E probably damaging Het
Sptan1 T C 2: 29,993,696 probably null Het
Stam T C 2: 14,138,141 C336R probably damaging Het
Stil G T 4: 115,041,298 A1042S probably damaging Het
Stxbp5l T A 16: 37,142,374 D773V possibly damaging Het
Sugct A T 13: 17,672,581 L39Q probably damaging Het
Tep1 A G 14: 50,834,065 V2041A possibly damaging Het
Tex15 C T 8: 33,581,502 probably benign Het
Tlr9 T G 9: 106,224,965 L485R possibly damaging Het
Tmem207 A G 16: 26,524,829 probably benign Het
Triml2 T C 8: 43,185,269 probably benign Het
Trip6 A G 5: 137,310,845 probably benign Het
Tspear T C 10: 77,869,631 F288L probably benign Het
Vmn1r179 C T 7: 23,929,167 T261I possibly damaging Het
Zfp644 A T 5: 106,637,003 S559R possibly damaging Het
Other mutations in Golga3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Golga3 APN 5 110220887 missense probably damaging 1.00
IGL00594:Golga3 APN 5 110204975 missense probably benign 0.37
IGL00672:Golga3 APN 5 110212244 missense probably damaging 1.00
IGL00821:Golga3 APN 5 110204933 missense possibly damaging 0.74
IGL01015:Golga3 APN 5 110187717 missense probably benign 0.04
IGL01408:Golga3 APN 5 110217809 critical splice acceptor site probably null
IGL01651:Golga3 APN 5 110192905 critical splice acceptor site probably null
IGL02617:Golga3 APN 5 110188746 missense probably benign 0.26
tenta UTSW 5 110218130 nonsense probably null
PIT4544001:Golga3 UTSW 5 110188690 missense possibly damaging 0.94
R0058:Golga3 UTSW 5 110202777 missense possibly damaging 0.85
R0591:Golga3 UTSW 5 110188743 missense probably damaging 1.00
R1219:Golga3 UTSW 5 110184349 nonsense probably null
R1297:Golga3 UTSW 5 110204843 missense probably benign 0.04
R1299:Golga3 UTSW 5 110204843 missense probably benign 0.04
R1465:Golga3 UTSW 5 110209878 missense probably damaging 1.00
R1465:Golga3 UTSW 5 110209878 missense probably damaging 1.00
R1589:Golga3 UTSW 5 110181783 missense probably damaging 1.00
R1795:Golga3 UTSW 5 110207627 missense possibly damaging 0.47
R1992:Golga3 UTSW 5 110192973 missense probably damaging 0.96
R2116:Golga3 UTSW 5 110187395 missense probably damaging 0.97
R2130:Golga3 UTSW 5 110202939 critical splice donor site probably null
R2153:Golga3 UTSW 5 110187990 splice site probably null
R2158:Golga3 UTSW 5 110187361 missense probably damaging 1.00
R2357:Golga3 UTSW 5 110202648 missense probably damaging 1.00
R2397:Golga3 UTSW 5 110205877 splice site probably benign
R2418:Golga3 UTSW 5 110201868 missense probably damaging 1.00
R2495:Golga3 UTSW 5 110207596 missense probably damaging 0.99
R2763:Golga3 UTSW 5 110204895 missense possibly damaging 0.87
R3276:Golga3 UTSW 5 110201998 splice site probably benign
R3614:Golga3 UTSW 5 110220908 missense probably damaging 1.00
R4520:Golga3 UTSW 5 110203751 nonsense probably null
R5001:Golga3 UTSW 5 110205777 missense probably damaging 1.00
R5046:Golga3 UTSW 5 110192940 missense probably damaging 0.99
R5157:Golga3 UTSW 5 110202671 missense probably benign 0.00
R5191:Golga3 UTSW 5 110184307 intron probably benign
R5376:Golga3 UTSW 5 110220945 critical splice donor site probably null
R5399:Golga3 UTSW 5 110205024 missense probably damaging 0.96
R5407:Golga3 UTSW 5 110201990 nonsense probably null
R5884:Golga3 UTSW 5 110216895 missense probably damaging 1.00
R6087:Golga3 UTSW 5 110204946 missense probably damaging 0.99
R6526:Golga3 UTSW 5 110204895 missense probably damaging 0.98
R6651:Golga3 UTSW 5 110218130 nonsense probably null
R7041:Golga3 UTSW 5 110208584 critical splice donor site probably null
R7057:Golga3 UTSW 5 110188663 missense probably damaging 1.00
R7078:Golga3 UTSW 5 110193087 missense probably damaging 0.99
R7114:Golga3 UTSW 5 110202712 missense probably benign 0.01
R7190:Golga3 UTSW 5 110209855 missense probably damaging 1.00
R7405:Golga3 UTSW 5 110208446 missense probably damaging 0.97
R7528:Golga3 UTSW 5 110212232 missense probably damaging 1.00
R7638:Golga3 UTSW 5 110205828 missense probably benign
R7760:Golga3 UTSW 5 110205850 missense probably benign 0.39
R8099:Golga3 UTSW 5 110188707 nonsense probably null
R8144:Golga3 UTSW 5 110185879 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CACTTCAGCAGGAGCACCTAGATG -3'
(R):5'- AGTCTATGGTTCCTCCACACCCAG -3'

Sequencing Primer
(F):5'- TGTGATAAAGCAGCTTACGTCG -3'
(R):5'- GGTGCAACAAGAACTACAGATTTC -3'
Posted On2013-05-09