Incidental Mutation 'R4565:Zfp618'
ID343280
Institutional Source Beutler Lab
Gene Symbol Zfp618
Ensembl Gene ENSMUSG00000028358
Gene Namezinc finger protein 618
SynonymsD430033D05Rik, 2810040O04Rik, 2810031P15Rik, Nedd10
MMRRC Submission 041790-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.167) question?
Stock #R4565 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location62965573-63139708 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 63121351 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 396 (C396R)
Ref Sequence ENSEMBL: ENSMUSP00000103038 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064814] [ENSMUST00000107415]
Predicted Effect probably damaging
Transcript: ENSMUST00000064814
AA Change: C303R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000069275
Gene: ENSMUSG00000028358
AA Change: C303R

DomainStartEndE-ValueType
ZnF_C2H2 114 136 5.06e-2 SMART
ZnF_C2H2 155 177 8.81e-2 SMART
ZnF_C2H2 243 265 2.91e-2 SMART
low complexity region 288 295 N/A INTRINSIC
ZnF_C2H2 298 320 2.53e-2 SMART
PDB:2BW3|A 377 690 5e-8 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000107415
AA Change: C396R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103038
Gene: ENSMUSG00000028358
AA Change: C396R

DomainStartEndE-ValueType
ZnF_C2H2 146 168 5.06e-2 SMART
ZnF_C2H2 187 209 8.81e-2 SMART
ZnF_C2H2 255 277 2.91e-2 SMART
low complexity region 381 388 N/A INTRINSIC
ZnF_C2H2 391 413 2.53e-2 SMART
PDB:2BW3|A 479 783 9e-8 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151324
Meta Mutation Damage Score 0.9669 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 97% (37/38)
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930011G23Rik T C 5: 99,227,947 probably benign Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Afg3l1 A T 8: 123,501,869 K725* probably null Het
Alkbh1 T C 12: 87,431,466 D225G probably damaging Het
Anxa2 A T 9: 69,489,737 K241M probably damaging Het
Bptf G A 11: 107,073,010 T1786M probably damaging Het
Cnst A G 1: 179,604,549 E208G probably damaging Het
Dcdc2b T C 4: 129,610,985 T118A probably benign Het
Dhx35 C A 2: 158,849,535 A646E probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dnhd1 T A 7: 105,651,956 D173E possibly damaging Het
Dpy19l1 A T 9: 24,432,388 L487Q probably null Het
Gtse1 T G 15: 85,875,184 V631G probably damaging Het
Haspin G A 11: 73,137,619 L215F probably benign Het
Herc2 T C 7: 56,153,838 V2207A possibly damaging Het
Jph1 A G 1: 17,004,202 Y531H possibly damaging Het
Limk2 A G 11: 3,348,634 I261T probably damaging Het
Oas3 A G 5: 120,771,039 F281L probably damaging Het
Olfr19 C A 16: 16,673,693 G96V probably damaging Het
Olfr447 A T 6: 42,911,538 Q5L probably benign Het
Pcdhb17 A G 18: 37,486,470 T438A probably benign Het
Pfdn5 T C 15: 102,326,785 probably benign Het
Rab11fip3 A G 17: 26,068,706 C158R possibly damaging Het
Rbmxl1 G A 8: 78,506,010 P235S probably benign Het
Slc9b1 G T 3: 135,382,717 V280F probably damaging Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Trpm3 T C 19: 22,987,869 I1576T probably benign Het
Trpm6 T A 19: 18,825,872 V893D probably damaging Het
Ttc13 A T 8: 124,682,087 N583K probably damaging Het
Other mutations in Zfp618
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01301:Zfp618 APN 4 63132826 missense probably damaging 1.00
IGL01563:Zfp618 APN 4 63079896 missense probably benign 0.38
IGL01726:Zfp618 APN 4 63132635 missense probably damaging 1.00
IGL02139:Zfp618 APN 4 63133536 missense probably damaging 1.00
IGL02182:Zfp618 APN 4 63095561 splice site probably benign
IGL02533:Zfp618 APN 4 63089405 missense probably damaging 1.00
IGL03231:Zfp618 APN 4 63094479 missense probably damaging 1.00
IGL03257:Zfp618 APN 4 63132671 missense probably damaging 1.00
ANU18:Zfp618 UTSW 4 63132826 missense probably damaging 1.00
IGL03014:Zfp618 UTSW 4 63080088 missense probably damaging 1.00
R0288:Zfp618 UTSW 4 63132934 missense possibly damaging 0.57
R0408:Zfp618 UTSW 4 63086572 missense probably damaging 0.97
R0685:Zfp618 UTSW 4 63133774 missense probably benign 0.21
R1482:Zfp618 UTSW 4 63115448 missense possibly damaging 0.64
R1585:Zfp618 UTSW 4 63132938 missense probably damaging 1.00
R1649:Zfp618 UTSW 4 63095537 missense probably damaging 1.00
R1744:Zfp618 UTSW 4 63086634 splice site probably benign
R1793:Zfp618 UTSW 4 63133237 missense probably damaging 0.97
R1952:Zfp618 UTSW 4 63132318 splice site probably null
R1996:Zfp618 UTSW 4 63131215 splice site probably null
R3792:Zfp618 UTSW 4 63115491 intron probably benign
R3803:Zfp618 UTSW 4 63133019 missense probably damaging 1.00
R3821:Zfp618 UTSW 4 63133564 missense probably benign 0.00
R3838:Zfp618 UTSW 4 63133564 missense probably benign 0.00
R4009:Zfp618 UTSW 4 63133564 missense probably benign 0.00
R4010:Zfp618 UTSW 4 63133564 missense probably benign 0.00
R4611:Zfp618 UTSW 4 63132979 missense probably damaging 1.00
R5019:Zfp618 UTSW 4 63103552 missense probably damaging 1.00
R5154:Zfp618 UTSW 4 63133209 missense probably damaging 1.00
R5183:Zfp618 UTSW 4 63099282 missense probably benign
R5354:Zfp618 UTSW 4 63080028 missense probably damaging 1.00
R5383:Zfp618 UTSW 4 63095492 missense probably benign 0.33
R5774:Zfp618 UTSW 4 63132562 missense probably damaging 1.00
R5932:Zfp618 UTSW 4 63118566 nonsense probably null
R6101:Zfp618 UTSW 4 63133241 missense probably benign 0.09
R6105:Zfp618 UTSW 4 63133241 missense probably benign 0.09
R6478:Zfp618 UTSW 4 63132706 missense probably damaging 1.00
R6598:Zfp618 UTSW 4 63089399 missense probably damaging 1.00
R7386:Zfp618 UTSW 4 63095385 critical splice donor site probably null
R7666:Zfp618 UTSW 4 63132717 nonsense probably null
R7678:Zfp618 UTSW 4 63086621 missense probably benign 0.07
R7975:Zfp618 UTSW 4 63131115 missense possibly damaging 0.93
R8276:Zfp618 UTSW 4 63132956 missense probably damaging 1.00
R8421:Zfp618 UTSW 4 63133246 missense probably damaging 1.00
X0011:Zfp618 UTSW 4 63080006 missense probably damaging 0.99
Z1176:Zfp618 UTSW 4 63095497 missense probably benign 0.29
Z1176:Zfp618 UTSW 4 63132763 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- AGTTAGCAGCCTATATCTGTGTGG -3'
(R):5'- GGGGCTCAGAAGGTAAGTTC -3'

Sequencing Primer
(F):5'- AGCCTATATCTGTGTGGCTTCC -3'
(R):5'- GTCCAGTTATAATGGGATGG -3'
Posted On2015-09-24