Incidental Mutation 'R4565:Dcdc2b'
ID343282
Institutional Source Beutler Lab
Gene Symbol Dcdc2b
Ensembl Gene ENSMUSG00000078552
Gene Namedoublecortin domain containing 2b
SynonymsGm12964, LOC384062
MMRRC Submission 041790-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4565 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location129608331-129614257 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 129610985 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 118 (T118A)
Ref Sequence ENSEMBL: ENSMUSP00000135913 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046675] [ENSMUST00000102591] [ENSMUST00000106037] [ENSMUST00000129515] [ENSMUST00000135628] [ENSMUST00000137090] [ENSMUST00000150110] [ENSMUST00000151969] [ENSMUST00000179209] [ENSMUST00000174073] [ENSMUST00000173758] [ENSMUST00000172774] [ENSMUST00000173937] [ENSMUST00000174819] [ENSMUST00000181579] [ENSMUST00000152126]
Predicted Effect probably benign
Transcript: ENSMUST00000046675
SMART Domains Protein: ENSMUSP00000040584
Gene: ENSMUSG00000040795

DomainStartEndE-ValueType
IQ 5 27 6.6e-2 SMART
low complexity region 150 160 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102591
SMART Domains Protein: ENSMUSP00000099651
Gene: ENSMUSG00000028797

DomainStartEndE-ValueType
Pfam:TMEM234 11 126 2.1e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106037
AA Change: T145A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000101653
Gene: ENSMUSG00000078552
AA Change: T145A

DomainStartEndE-ValueType
DCX 1 85 7.69e-26 SMART
DCX 118 205 6.22e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127029
Predicted Effect probably benign
Transcript: ENSMUST00000129515
SMART Domains Protein: ENSMUSP00000117184
Gene: ENSMUSG00000028797

DomainStartEndE-ValueType
Pfam:UPF0546 11 62 1.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135628
SMART Domains Protein: ENSMUSP00000120682
Gene: ENSMUSG00000028797

DomainStartEndE-ValueType
Pfam:UPF0546 11 62 1.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137090
SMART Domains Protein: ENSMUSP00000117568
Gene: ENSMUSG00000028797

DomainStartEndE-ValueType
Pfam:UPF0546 11 62 1.1e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143374
Predicted Effect probably benign
Transcript: ENSMUST00000145345
SMART Domains Protein: ENSMUSP00000122893
Gene: ENSMUSG00000028797

DomainStartEndE-ValueType
Pfam:TMEM234 6 56 2.8e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150110
SMART Domains Protein: ENSMUSP00000122513
Gene: ENSMUSG00000028797

DomainStartEndE-ValueType
Pfam:UPF0546 11 58 1.6e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151969
SMART Domains Protein: ENSMUSP00000120878
Gene: ENSMUSG00000028797

DomainStartEndE-ValueType
Pfam:UPF0546 11 62 1.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179209
AA Change: T118A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000135913
Gene: ENSMUSG00000078552
AA Change: T118A

DomainStartEndE-ValueType
DCX 1 86 1.32e-24 SMART
DCX 91 178 1.1e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172635
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174350
Predicted Effect probably benign
Transcript: ENSMUST00000174073
SMART Domains Protein: ENSMUSP00000133325
Gene: ENSMUSG00000028797

DomainStartEndE-ValueType
Pfam:UPF0546 11 62 1.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173758
SMART Domains Protein: ENSMUSP00000134588
Gene: ENSMUSG00000028797

DomainStartEndE-ValueType
Pfam:UPF0546 11 117 3.2e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172774
SMART Domains Protein: ENSMUSP00000133502
Gene: ENSMUSG00000028797

DomainStartEndE-ValueType
Pfam:UPF0546 11 62 1.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173937
SMART Domains Protein: ENSMUSP00000133412
Gene: ENSMUSG00000028797

DomainStartEndE-ValueType
Pfam:UPF0546 11 62 1.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174819
SMART Domains Protein: ENSMUSP00000133695
Gene: ENSMUSG00000028797

DomainStartEndE-ValueType
Pfam:UPF0546 11 57 1.5e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000181579
SMART Domains Protein: ENSMUSP00000137989
Gene: ENSMUSG00000028797

DomainStartEndE-ValueType
Pfam:UPF0546 11 124 4.4e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152126
SMART Domains Protein: ENSMUSP00000120224
Gene: ENSMUSG00000028797

DomainStartEndE-ValueType
Pfam:UPF0546 11 62 1.1e-12 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: This gene encodes a member of the doublecortin family. The protein encoded by this gene contains two doublecortin domains. The doublecortin domain has been demonstrated to bind tubulin and enhance microtubule polymerization. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930011G23Rik T C 5: 99,227,947 probably benign Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Afg3l1 A T 8: 123,501,869 K725* probably null Het
Alkbh1 T C 12: 87,431,466 D225G probably damaging Het
Anxa2 A T 9: 69,489,737 K241M probably damaging Het
Bptf G A 11: 107,073,010 T1786M probably damaging Het
Cnst A G 1: 179,604,549 E208G probably damaging Het
Dhx35 C A 2: 158,849,535 A646E probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dnhd1 T A 7: 105,651,956 D173E possibly damaging Het
Dpy19l1 A T 9: 24,432,388 L487Q probably null Het
Gtse1 T G 15: 85,875,184 V631G probably damaging Het
Haspin G A 11: 73,137,619 L215F probably benign Het
Herc2 T C 7: 56,153,838 V2207A possibly damaging Het
Jph1 A G 1: 17,004,202 Y531H possibly damaging Het
Limk2 A G 11: 3,348,634 I261T probably damaging Het
Oas3 A G 5: 120,771,039 F281L probably damaging Het
Olfr19 C A 16: 16,673,693 G96V probably damaging Het
Olfr447 A T 6: 42,911,538 Q5L probably benign Het
Pcdhb17 A G 18: 37,486,470 T438A probably benign Het
Pfdn5 T C 15: 102,326,785 probably benign Het
Rab11fip3 A G 17: 26,068,706 C158R possibly damaging Het
Rbmxl1 G A 8: 78,506,010 P235S probably benign Het
Slc9b1 G T 3: 135,382,717 V280F probably damaging Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Trpm3 T C 19: 22,987,869 I1576T probably benign Het
Trpm6 T A 19: 18,825,872 V893D probably damaging Het
Ttc13 A T 8: 124,682,087 N583K probably damaging Het
Zfp618 T C 4: 63,121,351 C396R probably damaging Het
Other mutations in Dcdc2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02104:Dcdc2b APN 4 129611074 missense probably benign 0.01
IGL03210:Dcdc2b APN 4 129611785 missense probably benign 0.02
R0094:Dcdc2b UTSW 4 129610311 splice site probably null
R0362:Dcdc2b UTSW 4 129610238 splice site probably null
R4677:Dcdc2b UTSW 4 129614143 missense probably damaging 1.00
R4911:Dcdc2b UTSW 4 129611267 missense possibly damaging 0.95
R5364:Dcdc2b UTSW 4 129609170 missense probably damaging 1.00
R7399:Dcdc2b UTSW 4 129609629 missense probably damaging 1.00
RF031:Dcdc2b UTSW 4 129609651 unclassified probably benign
RF033:Dcdc2b UTSW 4 129609651 unclassified probably benign
RF036:Dcdc2b UTSW 4 129609651 unclassified probably benign
RF039:Dcdc2b UTSW 4 129609651 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TGTTCCATACTCGTGTACAGCC -3'
(R):5'- GGAGCTCCAATTCCAATAGAAAG -3'

Sequencing Primer
(F):5'- ACCCCGTGCTCACTGTG -3'
(R):5'- GATTAAAAACCCAACATGAGAATGG -3'
Posted On2015-09-24