Incidental Mutation 'R4565:Olfr447'
ID343285
Institutional Source Beutler Lab
Gene Symbol Olfr447
Ensembl Gene ENSMUSG00000045708
Gene Nameolfactory receptor 447
SynonymsMOR261-1, GA_x6K02T2P3E9-4647978-4647046
MMRRC Submission 041790-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.141) question?
Stock #R4565 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location42908878-42914273 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 42911538 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 5 (Q5L)
Ref Sequence ENSEMBL: ENSMUSP00000149325 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055763] [ENSMUST00000216408]
Predicted Effect probably benign
Transcript: ENSMUST00000055763
AA Change: Q5L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000052312
Gene: ENSMUSG00000045708
AA Change: Q5L

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 1.8e-60 PFAM
Pfam:7tm_1 40 289 6.3e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216408
AA Change: Q5L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.1183 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930011G23Rik T C 5: 99,227,947 probably benign Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Afg3l1 A T 8: 123,501,869 K725* probably null Het
Alkbh1 T C 12: 87,431,466 D225G probably damaging Het
Anxa2 A T 9: 69,489,737 K241M probably damaging Het
Bptf G A 11: 107,073,010 T1786M probably damaging Het
Cnst A G 1: 179,604,549 E208G probably damaging Het
Dcdc2b T C 4: 129,610,985 T118A probably benign Het
Dhx35 C A 2: 158,849,535 A646E probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dnhd1 T A 7: 105,651,956 D173E possibly damaging Het
Dpy19l1 A T 9: 24,432,388 L487Q probably null Het
Gtse1 T G 15: 85,875,184 V631G probably damaging Het
Haspin G A 11: 73,137,619 L215F probably benign Het
Herc2 T C 7: 56,153,838 V2207A possibly damaging Het
Jph1 A G 1: 17,004,202 Y531H possibly damaging Het
Limk2 A G 11: 3,348,634 I261T probably damaging Het
Oas3 A G 5: 120,771,039 F281L probably damaging Het
Olfr19 C A 16: 16,673,693 G96V probably damaging Het
Pcdhb17 A G 18: 37,486,470 T438A probably benign Het
Pfdn5 T C 15: 102,326,785 probably benign Het
Rab11fip3 A G 17: 26,068,706 C158R possibly damaging Het
Rbmxl1 G A 8: 78,506,010 P235S probably benign Het
Slc9b1 G T 3: 135,382,717 V280F probably damaging Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Trpm3 T C 19: 22,987,869 I1576T probably benign Het
Trpm6 T A 19: 18,825,872 V893D probably damaging Het
Ttc13 A T 8: 124,682,087 N583K probably damaging Het
Zfp618 T C 4: 63,121,351 C396R probably damaging Het
Other mutations in Olfr447
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02302:Olfr447 APN 6 42912338 missense probably damaging 1.00
IGL02604:Olfr447 APN 6 42912058 nonsense probably null
IGL02894:Olfr447 APN 6 42911517 splice site probably benign
R0122:Olfr447 UTSW 6 42911955 missense probably benign 0.00
R0172:Olfr447 UTSW 6 42911979 missense probably benign 0.00
R0371:Olfr447 UTSW 6 42911938 missense probably benign 0.14
R1709:Olfr447 UTSW 6 42912144 missense possibly damaging 0.94
R2431:Olfr447 UTSW 6 42912012 missense probably damaging 0.99
R3809:Olfr447 UTSW 6 42912337 missense probably damaging 1.00
R4032:Olfr447 UTSW 6 42911625 missense probably benign 0.08
R4242:Olfr447 UTSW 6 42911546 missense possibly damaging 0.77
R4369:Olfr447 UTSW 6 42912277 nonsense probably null
R4401:Olfr447 UTSW 6 42912326 nonsense probably null
R5646:Olfr447 UTSW 6 42911523 splice site probably null
R5968:Olfr447 UTSW 6 42911546 missense probably benign
R6804:Olfr447 UTSW 6 42911918 missense probably benign
R6925:Olfr447 UTSW 6 42911857 nonsense probably null
R8170:Olfr447 UTSW 6 42912191 missense possibly damaging 0.73
R8358:Olfr447 UTSW 6 42912042 missense possibly damaging 0.51
Predicted Primers PCR Primer
(F):5'- CTGTACAGCCACCACCATGATG -3'
(R):5'- CAATGTCAACGATGGCCAGG -3'

Sequencing Primer
(F):5'- AGCATTTGCCTTATGAAATACCC -3'
(R):5'- TCAACGATGGCCAGGTGAGAC -3'
Posted On2015-09-24