Incidental Mutation 'R4565:Limk2'
ID343293
Institutional Source Beutler Lab
Gene Symbol Limk2
Ensembl Gene ENSMUSG00000020451
Gene NameLIM motif-containing protein kinase 2
SynonymsLimk2a, A930024P04Rik, LIM kinase 2, Limk2b
MMRRC Submission 041790-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R4565 (G1)
Quality Score211
Status Validated
Chromosome11
Chromosomal Location3344256-3409189 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3348634 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 261 (I261T)
Ref Sequence ENSEMBL: ENSMUSP00000105656 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101638] [ENSMUST00000101640] [ENSMUST00000101642] [ENSMUST00000110029]
Predicted Effect probably damaging
Transcript: ENSMUST00000101638
AA Change: I448T

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099162
Gene: ENSMUSG00000020451
AA Change: I448T

DomainStartEndE-ValueType
LIM 11 63 2e-14 SMART
LIM 71 124 4.63e-10 SMART
PDZ 161 239 7.04e-10 SMART
low complexity region 241 255 N/A INTRINSIC
low complexity region 280 306 N/A INTRINSIC
low complexity region 310 322 N/A INTRINSIC
Pfam:Pkinase 331 600 5.3e-48 PFAM
Pfam:Pkinase_Tyr 331 601 4.7e-50 PFAM
Pfam:Kdo 341 497 8.6e-7 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000101640
AA Change: I433T

PolyPhen 2 Score 0.728 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000099163
Gene: ENSMUSG00000020451
AA Change: I433T

DomainStartEndE-ValueType
LIM 7 42 4.91e-1 SMART
LIM 50 103 4.63e-10 SMART
PDZ 140 218 7.04e-10 SMART
low complexity region 220 234 N/A INTRINSIC
low complexity region 259 285 N/A INTRINSIC
low complexity region 289 301 N/A INTRINSIC
Pfam:Pkinase 310 582 1.2e-45 PFAM
Pfam:Pkinase_Tyr 310 586 1.3e-51 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000101642
AA Change: I427T

PolyPhen 2 Score 0.839 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000099165
Gene: ENSMUSG00000020451
AA Change: I427T

DomainStartEndE-ValueType
LIM 7 42 4.91e-1 SMART
LIM 50 103 4.63e-10 SMART
PDZ 140 218 7.04e-10 SMART
low complexity region 220 234 N/A INTRINSIC
low complexity region 259 285 N/A INTRINSIC
low complexity region 289 301 N/A INTRINSIC
Pfam:Pkinase 310 579 4.9e-48 PFAM
Pfam:Pkinase_Tyr 310 580 4.3e-50 PFAM
Pfam:Kdo 320 476 8.2e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110029
AA Change: I261T

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105656
Gene: ENSMUSG00000020451
AA Change: I261T

DomainStartEndE-ValueType
PDZ 1 52 4.55e-1 SMART
low complexity region 54 68 N/A INTRINSIC
low complexity region 93 119 N/A INTRINSIC
low complexity region 123 135 N/A INTRINSIC
Pfam:Pkinase 144 411 2.7e-49 PFAM
Pfam:Pkinase_Tyr 144 414 1.7e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123689
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134576
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142322
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142926
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148771
Meta Mutation Damage Score 0.8139 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] There are approximately 40 known eukaryotic LIM proteins, so named for the LIM domains they contain. LIM domains are highly conserved cysteine-rich structures containing 2 zinc fingers. Although zinc fingers usually function by binding to DNA or RNA, the LIM motif probably mediates protein-protein interactions. LIM kinase-1 and LIM kinase-2 belong to a small subfamily with a unique combination of 2 N-terminal LIM motifs and a C-terminal protein kinase domain. The protein encoded by this gene is phosphorylated and activated by ROCK, a downstream effector of Rho, and the encoded protein, in turn, phosphorylates cofilin, inhibiting its actin-depolymerizing activity. It is thought that this pathway contributes to Rho-induced reorganization of the actin cytoskeleton. At least three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Male homozygotes for targeted null mutations exhibit small testes but are fertile. Mutant kidneys have fewer glomeruli and dilated renal tubules, but function normally. Mice homozygous for a gene trap allele or spontaneous mutation have open eyelids at birth, corneal abnormalities and inflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930011G23Rik T C 5: 99,227,947 probably benign Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Afg3l1 A T 8: 123,501,869 K725* probably null Het
Alkbh1 T C 12: 87,431,466 D225G probably damaging Het
Anxa2 A T 9: 69,489,737 K241M probably damaging Het
Bptf G A 11: 107,073,010 T1786M probably damaging Het
Cnst A G 1: 179,604,549 E208G probably damaging Het
Dcdc2b T C 4: 129,610,985 T118A probably benign Het
Dhx35 C A 2: 158,849,535 A646E probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dnhd1 T A 7: 105,651,956 D173E possibly damaging Het
Dpy19l1 A T 9: 24,432,388 L487Q probably null Het
Gtse1 T G 15: 85,875,184 V631G probably damaging Het
Haspin G A 11: 73,137,619 L215F probably benign Het
Herc2 T C 7: 56,153,838 V2207A possibly damaging Het
Jph1 A G 1: 17,004,202 Y531H possibly damaging Het
Oas3 A G 5: 120,771,039 F281L probably damaging Het
Olfr19 C A 16: 16,673,693 G96V probably damaging Het
Olfr447 A T 6: 42,911,538 Q5L probably benign Het
Pcdhb17 A G 18: 37,486,470 T438A probably benign Het
Pfdn5 T C 15: 102,326,785 probably benign Het
Rab11fip3 A G 17: 26,068,706 C158R possibly damaging Het
Rbmxl1 G A 8: 78,506,010 P235S probably benign Het
Slc9b1 G T 3: 135,382,717 V280F probably damaging Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Trpm3 T C 19: 22,987,869 I1576T probably benign Het
Trpm6 T A 19: 18,825,872 V893D probably damaging Het
Ttc13 A T 8: 124,682,087 N583K probably damaging Het
Zfp618 T C 4: 63,121,351 C396R probably damaging Het
Other mutations in Limk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01105:Limk2 APN 11 3355475 splice site probably benign
IGL01592:Limk2 APN 11 3359052 missense probably benign 0.00
IGL01716:Limk2 APN 11 3358990 splice site probably null
IGL01911:Limk2 APN 11 3355340 missense probably benign
R0900:Limk2 UTSW 11 3350731 missense probably damaging 1.00
R1587:Limk2 UTSW 11 3353455 missense possibly damaging 0.82
R1632:Limk2 UTSW 11 3346250 missense probably damaging 1.00
R1695:Limk2 UTSW 11 3353275 critical splice donor site probably null
R1712:Limk2 UTSW 11 3358104 splice site probably null
R1792:Limk2 UTSW 11 3358236 missense probably benign
R1982:Limk2 UTSW 11 3355461 missense probably benign 0.00
R3009:Limk2 UTSW 11 3359046 missense probably benign 0.01
R4703:Limk2 UTSW 11 3347586 nonsense probably null
R4978:Limk2 UTSW 11 3409069 utr 5 prime probably benign
R5160:Limk2 UTSW 11 3350772 missense probably damaging 1.00
R5460:Limk2 UTSW 11 3352332 missense probably benign 0.30
R6497:Limk2 UTSW 11 3360492 missense probably benign 0.00
R6543:Limk2 UTSW 11 3350682 missense probably damaging 1.00
R6666:Limk2 UTSW 11 3360493 missense probably damaging 1.00
R7054:Limk2 UTSW 11 3355448 missense possibly damaging 0.95
R7330:Limk2 UTSW 11 3346311 missense probably benign 0.39
R7681:Limk2 UTSW 11 3353354 missense probably damaging 0.96
R7722:Limk2 UTSW 11 3356092 splice site probably null
R7745:Limk2 UTSW 11 3355896 missense probably damaging 0.99
R8120:Limk2 UTSW 11 3348589 splice site probably null
R8193:Limk2 UTSW 11 3347691 missense possibly damaging 0.79
R8379:Limk2 UTSW 11 3371162 start gained probably benign
Predicted Primers PCR Primer
(F):5'- CATGTGTGTATCTGAGAGCTTCC -3'
(R):5'- TTGCCTCAAGGATGGGAGAC -3'

Sequencing Primer
(F):5'- GTGTATCTGAGAGCTTCCATAAGATG -3'
(R):5'- TGGGAGACTCAGAGGCC -3'
Posted On2015-09-24