Incidental Mutation 'R4565:Haspin'
ID343295
Institutional Source Beutler Lab
Gene Symbol Haspin
Ensembl Gene ENSMUSG00000050107
Gene Namehistone H3 associated protein kinase
SynonymsGsg2
MMRRC Submission 041790-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.711) question?
Stock #R4565 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location73135485-73138294 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 73137619 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 215 (L215F)
Ref Sequence ENSEMBL: ENSMUSP00000055806 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006101] [ENSMUST00000052140] [ENSMUST00000102537]
Predicted Effect probably benign
Transcript: ENSMUST00000006101
SMART Domains Protein: ENSMUSP00000006101
Gene: ENSMUSG00000005947

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Blast:Int_alpha 36 118 1e-24 BLAST
VWA 193 380 1.13e-39 SMART
Int_alpha 448 496 1.49e-3 SMART
Int_alpha 502 559 6.83e-12 SMART
Int_alpha 565 626 1.79e-15 SMART
Int_alpha 633 685 6.29e0 SMART
transmembrane domain 1115 1137 N/A INTRINSIC
Pfam:Integrin_alpha 1138 1152 1.1e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000052140
AA Change: L215F

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000055806
Gene: ENSMUSG00000050107
AA Change: L215F

DomainStartEndE-ValueType
low complexity region 61 67 N/A INTRINSIC
low complexity region 74 89 N/A INTRINSIC
low complexity region 95 106 N/A INTRINSIC
low complexity region 357 378 N/A INTRINSIC
SCOP:d1h8fa_ 437 619 1e-8 SMART
DUF3635 664 753 3.83e-45 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102537
SMART Domains Protein: ENSMUSP00000099596
Gene: ENSMUSG00000005947

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Blast:Int_alpha 36 118 5e-25 BLAST
VWA 193 380 1.13e-39 SMART
Int_alpha 448 496 1.49e-3 SMART
Int_alpha 502 559 6.83e-12 SMART
Int_alpha 565 626 1.79e-15 SMART
Int_alpha 633 685 6.29e0 SMART
Meta Mutation Damage Score 0.0822 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 97% (37/38)
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930011G23Rik T C 5: 99,227,947 probably benign Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Afg3l1 A T 8: 123,501,869 K725* probably null Het
Alkbh1 T C 12: 87,431,466 D225G probably damaging Het
Anxa2 A T 9: 69,489,737 K241M probably damaging Het
Bptf G A 11: 107,073,010 T1786M probably damaging Het
Cnst A G 1: 179,604,549 E208G probably damaging Het
Dcdc2b T C 4: 129,610,985 T118A probably benign Het
Dhx35 C A 2: 158,849,535 A646E probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dnhd1 T A 7: 105,651,956 D173E possibly damaging Het
Dpy19l1 A T 9: 24,432,388 L487Q probably null Het
Gtse1 T G 15: 85,875,184 V631G probably damaging Het
Herc2 T C 7: 56,153,838 V2207A possibly damaging Het
Jph1 A G 1: 17,004,202 Y531H possibly damaging Het
Limk2 A G 11: 3,348,634 I261T probably damaging Het
Oas3 A G 5: 120,771,039 F281L probably damaging Het
Olfr19 C A 16: 16,673,693 G96V probably damaging Het
Olfr447 A T 6: 42,911,538 Q5L probably benign Het
Pcdhb17 A G 18: 37,486,470 T438A probably benign Het
Pfdn5 T C 15: 102,326,785 probably benign Het
Rab11fip3 A G 17: 26,068,706 C158R possibly damaging Het
Rbmxl1 G A 8: 78,506,010 P235S probably benign Het
Slc9b1 G T 3: 135,382,717 V280F probably damaging Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Trpm3 T C 19: 22,987,869 I1576T probably benign Het
Trpm6 T A 19: 18,825,872 V893D probably damaging Het
Ttc13 A T 8: 124,682,087 N583K probably damaging Het
Zfp618 T C 4: 63,121,351 C396R probably damaging Het
Other mutations in Haspin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01636:Haspin APN 11 73137405 missense possibly damaging 0.85
IGL03088:Haspin APN 11 73136625 missense probably damaging 1.00
IGL03103:Haspin APN 11 73136700 missense probably damaging 1.00
Suddenly UTSW 11 73136886 missense probably benign 0.02
yesterday UTSW 11 73137551 nonsense probably null
R0034:Haspin UTSW 11 73138218 missense probably damaging 1.00
R0276:Haspin UTSW 11 73136487 missense probably damaging 1.00
R0313:Haspin UTSW 11 73136298 missense probably damaging 0.97
R2165:Haspin UTSW 11 73136630 missense probably damaging 1.00
R2326:Haspin UTSW 11 73136085 missense probably benign 0.05
R3950:Haspin UTSW 11 73136395 missense probably damaging 1.00
R4168:Haspin UTSW 11 73136022 missense probably damaging 1.00
R6532:Haspin UTSW 11 73137551 nonsense probably null
R6552:Haspin UTSW 11 73137564 missense probably benign 0.02
R6952:Haspin UTSW 11 73136145 missense possibly damaging 0.95
R7237:Haspin UTSW 11 73136886 missense probably benign 0.02
R7512:Haspin UTSW 11 73136592 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACTGGACTCCTCATAGTC -3'
(R):5'- ACAGTGTGTGCATCCAGTC -3'

Sequencing Primer
(F):5'- GGACTCCTCATAGTCTCTCTGG -3'
(R):5'- TGCATCCAGTCCAGGGACAG -3'
Posted On2015-09-24