Incidental Mutation 'R4565:Alkbh1'
ID343298
Institutional Source Beutler Lab
Gene Symbol Alkbh1
Ensembl Gene ENSMUSG00000079036
Gene NamealkB homolog 1, histone H2A dioxygenase
SynonymsalkB, Nrp, Alkbh
MMRRC Submission 041790-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.253) question?
Stock #R4565 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location87425840-87444017 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87431466 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 225 (D225G)
Ref Sequence ENSEMBL: ENSMUSP00000124565 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159079] [ENSMUST00000160113] [ENSMUST00000161712] [ENSMUST00000162247] [ENSMUST00000162961] [ENSMUST00000162986]
Predicted Effect probably benign
Transcript: ENSMUST00000159079
SMART Domains Protein: ENSMUSP00000124445
Gene: ENSMUSG00000079036

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160113
SMART Domains Protein: ENSMUSP00000124691
Gene: ENSMUSG00000079036

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000160687
AA Change: D108G
SMART Domains Protein: ENSMUSP00000124892
Gene: ENSMUSG00000079036
AA Change: D108G

DomainStartEndE-ValueType
Pfam:2OG-FeII_Oxy_2 1 180 3.4e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160850
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160919
Predicted Effect probably benign
Transcript: ENSMUST00000161712
SMART Domains Protein: ENSMUSP00000124933
Gene: ENSMUSG00000079036

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162247
SMART Domains Protein: ENSMUSP00000124360
Gene: ENSMUSG00000079036

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000162961
AA Change: D225G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124565
Gene: ENSMUSG00000079036
AA Change: D225G

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
Pfam:2OG-FeII_Oxy_2 98 344 6.7e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162986
SMART Domains Protein: ENSMUSP00000125372
Gene: ENSMUSG00000079036

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176758
Meta Mutation Damage Score 0.4283 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a homolog to the E. coli alkB gene product. The E. coli alkB protein is part of the adaptive response mechanism of DNA alkylation damage repair. It is involved in damage reversal by oxidative demethylation of 1-methyladenine and 3-methylcytosine. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele show delayed fetal growth, impaired placental development and low birth weight. Mice homozygous for another null allele show sex-ratio distortion, reduced survival, spermatogenic defects and incompletely penetrant eye, neural tube, skeleton and craniofacial defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930011G23Rik T C 5: 99,227,947 probably benign Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Afg3l1 A T 8: 123,501,869 K725* probably null Het
Anxa2 A T 9: 69,489,737 K241M probably damaging Het
Bptf G A 11: 107,073,010 T1786M probably damaging Het
Cnst A G 1: 179,604,549 E208G probably damaging Het
Dcdc2b T C 4: 129,610,985 T118A probably benign Het
Dhx35 C A 2: 158,849,535 A646E probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dnhd1 T A 7: 105,651,956 D173E possibly damaging Het
Dpy19l1 A T 9: 24,432,388 L487Q probably null Het
Gtse1 T G 15: 85,875,184 V631G probably damaging Het
Haspin G A 11: 73,137,619 L215F probably benign Het
Herc2 T C 7: 56,153,838 V2207A possibly damaging Het
Jph1 A G 1: 17,004,202 Y531H possibly damaging Het
Limk2 A G 11: 3,348,634 I261T probably damaging Het
Oas3 A G 5: 120,771,039 F281L probably damaging Het
Olfr19 C A 16: 16,673,693 G96V probably damaging Het
Olfr447 A T 6: 42,911,538 Q5L probably benign Het
Pcdhb17 A G 18: 37,486,470 T438A probably benign Het
Pfdn5 T C 15: 102,326,785 probably benign Het
Rab11fip3 A G 17: 26,068,706 C158R possibly damaging Het
Rbmxl1 G A 8: 78,506,010 P235S probably benign Het
Slc9b1 G T 3: 135,382,717 V280F probably damaging Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Trpm3 T C 19: 22,987,869 I1576T probably benign Het
Trpm6 T A 19: 18,825,872 V893D probably damaging Het
Ttc13 A T 8: 124,682,087 N583K probably damaging Het
Zfp618 T C 4: 63,121,351 C396R probably damaging Het
Other mutations in Alkbh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Alkbh1 APN 12 87443697 missense probably damaging 1.00
IGL03111:Alkbh1 APN 12 87434137 missense probably damaging 1.00
IGL03264:Alkbh1 APN 12 87431427 missense probably damaging 1.00
R1439:Alkbh1 UTSW 12 87429145 missense probably damaging 1.00
R2056:Alkbh1 UTSW 12 87443750 unclassified probably benign
R2058:Alkbh1 UTSW 12 87443750 unclassified probably benign
R2059:Alkbh1 UTSW 12 87443750 unclassified probably benign
R5712:Alkbh1 UTSW 12 87429113 missense probably benign 0.05
R6291:Alkbh1 UTSW 12 87429094 missense possibly damaging 0.67
R7593:Alkbh1 UTSW 12 87440325 nonsense probably null
R7776:Alkbh1 UTSW 12 87431445 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGCAGGCTTCATGTTTTACTCTG -3'
(R):5'- CAATTTCCTGTGGTCTGAGATCG -3'

Sequencing Primer
(F):5'- GTATGTTGCTCTGCTTTTAGAAAAC -3'
(R):5'- TGGTCTGAGATCGTTTATTTTTCC -3'
Posted On2015-09-24