Mutagenetix > Incidental Mutation

Incidental Mutation 'R4569:Sbf2'

343300

Institutional Source

Beutler Lab

Gene Symbol

Sbf2

Ensembl Gene

ENSMUSG00000038371

Gene Name

SET binding factor 2

Synonyms

mMTMH1, 4833411B01Rik, Mtmr13, B430219L04Rik, SBF2

MMRRC Submission

041793-MU

Accession Numbers

Genbank: NM_177324; MGI: 1921831

Essential gene?

Possibly non essential (E-score: 0.295) question?

Stock #

R4569 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

110308013-110614922 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to G at 110348853 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000126217 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033058] [ENSMUST00000033058] [ENSMUST00000164759] [ENSMUST00000164759] [ENSMUST00000166020] [ENSMUST00000166020]

AlphaFold

E9PXF8

Predicted Effect

probably null
Transcript: ENSMUST00000033058

SMART Domains

Protein: ENSMUSP00000033058
Gene: ENSMUSG00000038371

Domain	Start	End	E-Value	Type
uDENN	1	87	2.27e-33	SMART
DENN	116	298	5.68e-75	SMART
dDENN	351	420	2e-20	SMART
Pfam:SBF2	530	752	3.3e-106	PFAM
GRAM	869	955	1.3e-12	SMART
low complexity region	1078	1089	N/A	INTRINSIC
Pfam:Myotub-related	1091	1544	8.3e-86	PFAM
PH	1767	1872	3.05e-18	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000033058

SMART Domains

Protein: ENSMUSP00000033058
Gene: ENSMUSG00000038371

Domain	Start	End	E-Value	Type
uDENN	1	87	2.27e-33	SMART
DENN	116	298	5.68e-75	SMART
dDENN	351	420	2e-20	SMART
Pfam:SBF2	530	752	3.3e-106	PFAM
GRAM	869	955	1.3e-12	SMART
low complexity region	1078	1089	N/A	INTRINSIC
Pfam:Myotub-related	1091	1544	8.3e-86	PFAM
PH	1767	1872	3.05e-18	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000164525

SMART Domains

Protein: ENSMUSP00000128340
Gene: ENSMUSG00000038371

Domain	Start	End	E-Value	Type
low complexity region	16	27	N/A	INTRINSIC
Pfam:Myotub-related	28	217	1.5e-21	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000164525

SMART Domains

Protein: ENSMUSP00000128340
Gene: ENSMUSG00000038371

Domain	Start	End	E-Value	Type
low complexity region	16	27	N/A	INTRINSIC
Pfam:Myotub-related	28	217	1.5e-21	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000164599

SMART Domains

Protein: ENSMUSP00000131927
Gene: ENSMUSG00000038371

Domain	Start	End	E-Value	Type
Pfam:Myotub-related	1	339	1.9e-34	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000164599

SMART Domains

Protein: ENSMUSP00000131927
Gene: ENSMUSG00000038371

Domain	Start	End	E-Value	Type
Pfam:Myotub-related	1	339	1.9e-34	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000164759

SMART Domains

Protein: ENSMUSP00000132072
Gene: ENSMUSG00000038371

Domain	Start	End	E-Value	Type
uDENN	1	87	2.27e-33	SMART
DENN	116	298	5.68e-75	SMART
dDENN	351	420	2e-20	SMART
Pfam:SBF2	528	752	1.6e-107	PFAM
GRAM	869	955	1.3e-12	SMART
Pfam:Myotub-related	1089	1521	1.6e-98	PFAM
PH	1742	1847	3.05e-18	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000164759

SMART Domains

Protein: ENSMUSP00000132072
Gene: ENSMUSG00000038371

Domain	Start	End	E-Value	Type
uDENN	1	87	2.27e-33	SMART
DENN	116	298	5.68e-75	SMART
dDENN	351	420	2e-20	SMART
Pfam:SBF2	528	752	1.6e-107	PFAM
GRAM	869	955	1.3e-12	SMART
Pfam:Myotub-related	1089	1521	1.6e-98	PFAM
PH	1742	1847	3.05e-18	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000166020

SMART Domains

Protein: ENSMUSP00000126217
Gene: ENSMUSG00000038371

Domain	Start	End	E-Value	Type
uDENN	1	75	9.26e-1	SMART
DENN	70	252	5.68e-75	SMART
dDENN	305	374	2e-20	SMART
Pfam:SBF2	482	706	1.6e-107	PFAM
GRAM	823	909	1.3e-12	SMART
Pfam:Myotub-related	1043	1500	5.9e-98	PFAM
PH	1721	1826	3.05e-18	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000166020

SMART Domains

Protein: ENSMUSP00000126217
Gene: ENSMUSG00000038371

Domain	Start	End	E-Value	Type
uDENN	1	75	9.26e-1	SMART
DENN	70	252	5.68e-75	SMART
dDENN	305	374	2e-20	SMART
Pfam:SBF2	482	706	1.6e-107	PFAM
GRAM	823	909	1.3e-12	SMART
Pfam:Myotub-related	1043	1500	5.9e-98	PFAM
PH	1721	1826	3.05e-18	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000169740

Meta Mutation Damage Score

0.9489

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 94.9%

Validation Efficiency

99% (87/88)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a pseudophosphatase and member of the myotubularin-related protein family. This gene maps within the CMT4B2 candidate region of chromosome 11p15 and mutations in this gene have been associated with Charcot-Marie-Tooth Disease, type 4B2. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for null alleles display progressive misfolding of myelin sheaths and abnormal nerve electrophysiology. [provided by MGI curators]

Allele List at MGI

All alleles(11) : Targeted, other(2) Gene trapped(9)

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610021A01Rik	A	G	7: 41,625,838	T322A	probably benign	Het
Abhd13	C	T	8: 9,988,071	P223S	possibly damaging	Het
Adgra3	T	A	5: 49,960,563	L1214F	probably damaging	Het
Alkbh2	C	T	5: 114,124,226	E148K	probably damaging	Het
Ankrd13a	C	A	5: 114,789,312	P120Q	probably damaging	Het
Apbb1ip	A	G	2: 22,849,544	Y277C	probably damaging	Het
Arfgap1	T	C	2: 180,976,373		probably benign	Het
Arid2	T	A	15: 96,392,462	V1746D	probably damaging	Het
C1qtnf7	T	A	5: 43,609,207	N49K	possibly damaging	Het
Cacnb2	A	T	2: 14,986,000	D587V	possibly damaging	Het
Ccar2	A	T	14: 70,151,910		probably null	Het
Cdk2ap2	T	C	19: 4,097,879	F49L	possibly damaging	Het
Cdon	A	T	9: 35,476,969	I747F	probably damaging	Het
Cyp19a1	G	A	9: 54,193,323	P27S	probably benign	Het
Cyp4v3	T	A	8: 45,306,992	R508W	probably damaging	Het
Dclk1	T	C	3: 55,247,410	L87P	probably damaging	Het
Ddx41	G	A	13: 55,536,021	R66C	possibly damaging	Het
Dmxl1	T	C	18: 49,852,360	Y225H	probably damaging	Het
Dnah7a	G	A	1: 53,411,659	P3871S	probably benign	Het
Dnhd1	A	G	7: 105,657,166		probably null	Het
Dph1	A	T	11: 75,178,895		probably benign	Het
Egln2	A	G	7: 27,159,583	I382T	probably damaging	Het
Enpp3	A	G	10: 24,776,882	Y726H	probably damaging	Het
Fbxo32	A	G	15: 58,181,477	F353L	probably damaging	Het
Fchsd2	G	A	7: 101,277,602	G657D	possibly damaging	Het
Fer1l4	T	A	2: 156,036,639	E44V	possibly damaging	Het
Gjb2	C	T	14: 57,100,305	V149I	probably benign	Het
Glipr1l1	A	G	10: 112,062,412	M141V	probably benign	Het
Gnaq	T	C	19: 16,335,006	S211P	probably damaging	Het
Gnl1	A	G	17: 35,988,250	R527G	probably benign	Het
Gns	A	G	10: 121,381,178	Q286R	probably benign	Het
Gon4l	T	C	3: 88,910,090		probably benign	Het
Gpr107	T	C	2: 31,207,665		probably benign	Het
Gprasp1	C	T	X: 135,802,843	R1262C	probably damaging	Het
Gtf2ird1	A	T	5: 134,411,003	D124E	probably damaging	Het
Hbp1	T	A	12: 31,950,232		probably benign	Het
Hrnr	C	T	3: 93,323,568	T371I	unknown	Het
Ints2	A	G	11: 86,256,198	C41R	probably damaging	Het
Jhy	A	G	9: 40,911,093	I583T	probably benign	Het
Jph4	G	T	14: 55,115,046	R77S	probably damaging	Het
Kcnd3	C	T	3: 105,658,766	A421V	probably damaging	Het
Klhl12	A	T	1: 134,485,769	I331F	probably benign	Het
Map4k4	G	A	1: 40,000,538	R30Q	probably damaging	Het
Mettl11b	T	A	1: 163,703,017	*284C	probably null	Het
Mgst1	C	A	6: 138,156,215	T176K	probably damaging	Het
Negr1	C	A	3: 157,208,376		probably benign	Het
Nrg1	C	T	8: 31,917,774	V144I	probably benign	Het
Olfr51	T	C	11: 51,007,554	I194T	possibly damaging	Het
Otog	A	G	7: 46,310,147	D720G	probably damaging	Het
Pex11b	A	T	3: 96,644,014		probably benign	Het
Phtf2	T	C	5: 20,789,595		probably benign	Het
Ppip5k1	C	T	2: 121,343,563	R359Q	possibly damaging	Het
Prickle2	T	C	6: 92,422,342	I185V	probably benign	Het
Prrc2a	G	A	17: 35,158,497	P562S	unknown	Het
Rdx	A	G	9: 52,068,841	I245V	probably benign	Het
Rem2	T	C	14: 54,477,659	S98P	probably damaging	Het
Rhob	T	G	12: 8,499,373	D87A	probably damaging	Het
Ros1	T	A	10: 52,163,994	E300D	probably damaging	Het
Sipa1l3	G	T	7: 29,325,862	P619Q	probably damaging	Het
Snupn	A	G	9: 56,978,062	E217G	probably benign	Het
Ston2	T	A	12: 91,639,722	*896C	probably null	Het
Stradb	C	T	1: 58,979,958	R13*	probably null	Het
Tbx21	G	A	11: 97,114,755	A128V	probably benign	Het
Tep1	A	T	14: 50,824,740	C2552S	probably benign	Het
Tgif1	A	T	17: 70,844,917	V233E	possibly damaging	Het
Trim31	A	T	17: 36,898,741	I130L	probably benign	Het
Trrap	C	T	5: 144,792,118	T614I	probably benign	Het
Ttn	C	A	2: 76,936,414	V3107F	probably damaging	Het
Txnrd2	T	G	16: 18,456,206	D322E	probably benign	Het
Unc45b	T	A	11: 82,936,489		probably null	Het
Usp43	A	T	11: 67,875,352	L744*	probably null	Het
Usp43	C	T	11: 67,898,962	C252Y	probably damaging	Het
Vmn2r71	A	C	7: 85,624,194	K739Q	possibly damaging	Het
Vps16	C	T	2: 130,442,204	T653M	probably benign	Het
Wdr83os	T	A	8: 85,081,866	S82R	probably damaging	Het
Xpo6	T	A	7: 126,128,255	L526F	probably damaging	Het
Zfhx4	G	A	3: 5,401,834	V2351I	probably benign	Het
Zfp558	A	T	9: 18,456,503	C330S	possibly damaging	Het

Other mutations in Sbf2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00421:Sbf2	APN	7	110375832	splice site	probably benign
IGL01089:Sbf2	APN	7	110348962	missense	probably damaging	1.00
IGL01144:Sbf2	APN	7	110329903	missense	probably damaging	1.00
IGL01652:Sbf2	APN	7	110447120	missense	probably damaging	1.00
IGL01950:Sbf2	APN	7	110365825	missense	probably benign	0.00
IGL02027:Sbf2	APN	7	110461141	missense	probably damaging	1.00
IGL02244:Sbf2	APN	7	110560295	missense	probably damaging	1.00
IGL02376:Sbf2	APN	7	110462956	missense	probably damaging	0.99
IGL03405:Sbf2	APN	7	110462932	missense	probably damaging	0.98
N/A - 535:Sbf2	UTSW	7	110312752	missense	probably benign
R0084:Sbf2	UTSW	7	110442366	missense	possibly damaging	0.95
R0092:Sbf2	UTSW	7	110320806	splice site	probably benign
R0121:Sbf2	UTSW	7	110489219	critical splice donor site	probably null
R0464:Sbf2	UTSW	7	110464576	splice site	probably benign
R0505:Sbf2	UTSW	7	110399343	missense	probably damaging	1.00
R0531:Sbf2	UTSW	7	110367323	splice site	probably benign
R0554:Sbf2	UTSW	7	110428287	missense	probably damaging	1.00
R0617:Sbf2	UTSW	7	110330683	frame shift	probably null
R0619:Sbf2	UTSW	7	110310262	missense	possibly damaging	0.87
R0799:Sbf2	UTSW	7	110341355	missense	possibly damaging	0.58
R0898:Sbf2	UTSW	7	110371652	missense	possibly damaging	0.59
R1077:Sbf2	UTSW	7	110367172	splice site	probably benign
R1167:Sbf2	UTSW	7	110364549	missense	probably damaging	1.00
R1169:Sbf2	UTSW	7	110310184	missense	probably benign	0.04
R1424:Sbf2	UTSW	7	110315026	missense	probably damaging	1.00
R1536:Sbf2	UTSW	7	110378043	missense	probably damaging	1.00
R1558:Sbf2	UTSW	7	110428346	missense	probably damaging	1.00
R1601:Sbf2	UTSW	7	110340076	critical splice acceptor site	probably null
R1762:Sbf2	UTSW	7	110312758	missense	probably benign
R1771:Sbf2	UTSW	7	110461146	nonsense	probably null
R1989:Sbf2	UTSW	7	110348923	missense	possibly damaging	0.94
R2109:Sbf2	UTSW	7	110461212	missense	probably damaging	1.00
R2126:Sbf2	UTSW	7	110560295	missense	probably damaging	1.00
R2444:Sbf2	UTSW	7	110330698	missense	probably benign	0.31
R3765:Sbf2	UTSW	7	110375581	missense	probably damaging	1.00
R3808:Sbf2	UTSW	7	110489280	makesense	probably null
R3895:Sbf2	UTSW	7	110447091	missense	probably damaging	0.99
R3978:Sbf2	UTSW	7	110329885	missense	probably benign	0.00
R4056:Sbf2	UTSW	7	110441466	missense	probably damaging	0.99
R4057:Sbf2	UTSW	7	110441466	missense	probably damaging	0.99
R4111:Sbf2	UTSW	7	110428242	missense	probably damaging	1.00
R4670:Sbf2	UTSW	7	110335399	missense	probably damaging	1.00
R4763:Sbf2	UTSW	7	110420917	missense	probably damaging	1.00
R4792:Sbf2	UTSW	7	110351610	missense	probably damaging	0.98
R4811:Sbf2	UTSW	7	110372535	missense	probably damaging	1.00
R4822:Sbf2	UTSW	7	110377939	intron	probably benign
R5110:Sbf2	UTSW	7	110364657	missense	probably benign	0.10
R5143:Sbf2	UTSW	7	110422540	nonsense	probably null
R5443:Sbf2	UTSW	7	110377928	intron	probably benign
R5457:Sbf2	UTSW	7	110312830	missense	probably benign
R5641:Sbf2	UTSW	7	110438901	missense	probably damaging	1.00
R5915:Sbf2	UTSW	7	110378096	nonsense	probably null
R5948:Sbf2	UTSW	7	110489285	missense	probably damaging	1.00
R5977:Sbf2	UTSW	7	110377986	missense	probably benign	0.00
R6052:Sbf2	UTSW	7	110441534	missense	probably damaging	1.00
R6142:Sbf2	UTSW	7	110348975	missense	probably damaging	1.00
R6327:Sbf2	UTSW	7	110441552	missense	probably damaging	1.00
R6356:Sbf2	UTSW	7	110372623	missense	probably damaging	1.00
R6450:Sbf2	UTSW	7	110462863	missense	probably damaging	1.00
R6587:Sbf2	UTSW	7	110440975	missense	probably damaging	1.00
R6696:Sbf2	UTSW	7	110560298	missense	probably benign	0.04
R6986:Sbf2	UTSW	7	110330615	missense	probably damaging	0.99
R7147:Sbf2	UTSW	7	110447061	missense	probably benign	0.01
R7358:Sbf2	UTSW	7	110399348	missense	possibly damaging	0.95
R7414:Sbf2	UTSW	7	110314064	missense	possibly damaging	0.89
R7418:Sbf2	UTSW	7	110365821	missense	probably damaging	1.00
R7423:Sbf2	UTSW	7	110438848	missense	possibly damaging	0.48
R7425:Sbf2	UTSW	7	110375777	nonsense	probably null
R7431:Sbf2	UTSW	7	110351750	missense	probably damaging	1.00
R7497:Sbf2	UTSW	7	110614716	nonsense	probably null
R7556:Sbf2	UTSW	7	110314053	missense	probably benign	0.20
R7604:Sbf2	UTSW	7	110378067	missense	possibly damaging	0.95
R7707:Sbf2	UTSW	7	110330713	critical splice acceptor site	probably null
R7746:Sbf2	UTSW	7	110441426	missense	probably benign	0.01
R7812:Sbf2	UTSW	7	110449963	missense	possibly damaging	0.84
R7849:Sbf2	UTSW	7	110372510	missense	probably damaging	1.00
R8026:Sbf2	UTSW	7	110335387	missense	probably damaging	1.00
R8048:Sbf2	UTSW	7	110315082	missense	probably benign	0.21
R8305:Sbf2	UTSW	7	110371618	missense	possibly damaging	0.79
R8337:Sbf2	UTSW	7	110441462	missense	probably benign
R8773:Sbf2	UTSW	7	110348995	missense	probably benign
R8786:Sbf2	UTSW	7	110464586	critical splice donor site	probably null
R8812:Sbf2	UTSW	7	110329862	missense	probably damaging	1.00
R8876:Sbf2	UTSW	7	110449939	missense	probably damaging	0.99
R8932:Sbf2	UTSW	7	110440948	critical splice donor site	probably null
R8954:Sbf2	UTSW	7	110438911	nonsense	probably null
R8991:Sbf2	UTSW	7	110312689	missense	probably benign	0.20
R9119:Sbf2	UTSW	7	110312085	missense	possibly damaging	0.93
R9310:Sbf2	UTSW	7	110315085	missense	possibly damaging	0.58
R9344:Sbf2	UTSW	7	110341328	missense	probably benign	0.10
R9346:Sbf2	UTSW	7	110320739	missense	probably benign	0.05
R9404:Sbf2	UTSW	7	110441495	missense	possibly damaging	0.81
R9406:Sbf2	UTSW	7	110441495	missense	possibly damaging	0.81
R9408:Sbf2	UTSW	7	110441495	missense	possibly damaging	0.81
R9472:Sbf2	UTSW	7	110371591	missense	possibly damaging	0.88
R9554:Sbf2	UTSW	7	110441464	missense	probably damaging	1.00
R9562:Sbf2	UTSW	7	110441495	missense	possibly damaging	0.81
R9624:Sbf2	UTSW	7	110364650	missense	probably damaging	1.00
R9652:Sbf2	UTSW	7	110441495	missense	possibly damaging	0.81
R9653:Sbf2	UTSW	7	110441495	missense	possibly damaging	0.81
R9709:Sbf2	UTSW	7	110428307	missense	probably damaging	0.99
RF005:Sbf2	UTSW	7	110317008	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTAGACATTAACAGTGGTGCTTTG -3'
(R):5'- GTGTATTGAAACCAGCATCAAAAGGC -3'

Sequencing Primer
(F):5'- GACATTAACAGTGGTGCTTTGATTTC -3'
(R):5'- AACGTCTAACTGGCTTATATTTGGG -3'

Posted On

2015-09-24