Incidental Mutation 'R4565:Olfr19'
ID343302
Institutional Source Beutler Lab
Gene Symbol Olfr19
Ensembl Gene ENSMUSG00000048101
Gene Nameolfactory receptor 19
SynonymsGA_x54KRFPKG5P-13123979-13123050, M12, MTPCR15, MOR140-1
MMRRC Submission 041790-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.177) question?
Stock #R4565 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location16672228-16676405 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 16673693 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Valine at position 96 (G96V)
Ref Sequence ENSEMBL: ENSMUSP00000145655 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057886] [ENSMUST00000206365]
Predicted Effect probably damaging
Transcript: ENSMUST00000057886
AA Change: G96V

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000053393
Gene: ENSMUSG00000048101
AA Change: G96V

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 3e-50 PFAM
Pfam:7TM_GPCR_Srsx 35 190 9.6e-8 PFAM
Pfam:7tm_1 41 290 2.9e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000206365
AA Change: G96V

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206799
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930011G23Rik T C 5: 99,227,947 probably benign Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Afg3l1 A T 8: 123,501,869 K725* probably null Het
Alkbh1 T C 12: 87,431,466 D225G probably damaging Het
Anxa2 A T 9: 69,489,737 K241M probably damaging Het
Bptf G A 11: 107,073,010 T1786M probably damaging Het
Cnst A G 1: 179,604,549 E208G probably damaging Het
Dcdc2b T C 4: 129,610,985 T118A probably benign Het
Dhx35 C A 2: 158,849,535 A646E probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dnhd1 T A 7: 105,651,956 D173E possibly damaging Het
Dpy19l1 A T 9: 24,432,388 L487Q probably null Het
Gtse1 T G 15: 85,875,184 V631G probably damaging Het
Haspin G A 11: 73,137,619 L215F probably benign Het
Herc2 T C 7: 56,153,838 V2207A possibly damaging Het
Jph1 A G 1: 17,004,202 Y531H possibly damaging Het
Limk2 A G 11: 3,348,634 I261T probably damaging Het
Oas3 A G 5: 120,771,039 F281L probably damaging Het
Olfr447 A T 6: 42,911,538 Q5L probably benign Het
Pcdhb17 A G 18: 37,486,470 T438A probably benign Het
Pfdn5 T C 15: 102,326,785 probably benign Het
Rab11fip3 A G 17: 26,068,706 C158R possibly damaging Het
Rbmxl1 G A 8: 78,506,010 P235S probably benign Het
Slc9b1 G T 3: 135,382,717 V280F probably damaging Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Trpm3 T C 19: 22,987,869 I1576T probably benign Het
Trpm6 T A 19: 18,825,872 V893D probably damaging Het
Ttc13 A T 8: 124,682,087 N583K probably damaging Het
Zfp618 T C 4: 63,121,351 C396R probably damaging Het
Other mutations in Olfr19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01546:Olfr19 APN 16 16673265 missense probably damaging 1.00
IGL01790:Olfr19 APN 16 16673103 missense probably damaging 1.00
IGL03105:Olfr19 APN 16 16673526 missense probably benign 0.00
PIT4418001:Olfr19 UTSW 16 16673855 missense probably damaging 1.00
R1891:Olfr19 UTSW 16 16673577 missense probably damaging 0.99
R1969:Olfr19 UTSW 16 16673583 missense probably benign 0.00
R2138:Olfr19 UTSW 16 16673205 missense probably damaging 1.00
R3765:Olfr19 UTSW 16 16673315 missense probably benign 0.05
R4193:Olfr19 UTSW 16 16673647 missense possibly damaging 0.76
R4897:Olfr19 UTSW 16 16673618 missense probably damaging 1.00
R5753:Olfr19 UTSW 16 16673620 nonsense probably null
R6505:Olfr19 UTSW 16 16673920 missense probably benign 0.01
R7460:Olfr19 UTSW 16 16673166 missense possibly damaging 0.77
R7562:Olfr19 UTSW 16 16673715 missense probably benign 0.00
R7818:Olfr19 UTSW 16 16673573 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGCTGTTGTGACCCAAGACC -3'
(R):5'- GGATCCTCTATGGCAACCTTTC -3'

Sequencing Primer
(F):5'- GTTGTGACCCAAGACCCCAAAAC -3'
(R):5'- ACTTGGTCACTCTGCTTGGGAAC -3'
Posted On2015-09-24