Mutagenetix > Incidental Mutation

Incidental Mutation 'R4569:Unc45b'

343312

Institutional Source

Beutler Lab

Gene Symbol

Unc45b

Ensembl Gene

ENSMUSG00000018845

Gene Name

unc-45 myosin chaperone B

Synonyms

Cmya4, D230041A13Rik, UNC45

MMRRC Submission

041793-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4569 (G1)

Quality Score

169

Status

Validated

Chromosome

Chromosomal Location

82910550-82943403 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to A at 82936489 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000129405 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018989] [ENSMUST00000018989] [ENSMUST00000108160] [ENSMUST00000108160] [ENSMUST00000164945] [ENSMUST00000164945]

AlphaFold

Q8CGY6

Predicted Effect

probably null
Transcript: ENSMUST00000018989

SMART Domains

Protein: ENSMUSP00000018989
Gene: ENSMUSG00000018845

Domain	Start	End	E-Value	Type
TPR	6	39	1.02e1	SMART
TPR	43	76	7.47e0	SMART
TPR	77	110	2.52e-1	SMART
Blast:ARM	167	208	3e-16	BLAST
Blast:ARM	210	250	1e-10	BLAST
Pfam:UNC45-central	298	489	1.7e-41	PFAM
Blast:ARM	541	582	7e-7	BLAST
Blast:ARM	661	701	2e-14	BLAST
Blast:ARM	704	746	5e-11	BLAST
Blast:ARM	747	788	1e-20	BLAST
Blast:ARM	789	820	1e-11	BLAST
low complexity region	821	832	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000018989

SMART Domains

Protein: ENSMUSP00000018989
Gene: ENSMUSG00000018845

Domain	Start	End	E-Value	Type
TPR	6	39	1.02e1	SMART
TPR	43	76	7.47e0	SMART
TPR	77	110	2.52e-1	SMART
Blast:ARM	167	208	3e-16	BLAST
Blast:ARM	210	250	1e-10	BLAST
Pfam:UNC45-central	298	489	1.7e-41	PFAM
Blast:ARM	541	582	7e-7	BLAST
Blast:ARM	661	701	2e-14	BLAST
Blast:ARM	704	746	5e-11	BLAST
Blast:ARM	747	788	1e-20	BLAST
Blast:ARM	789	820	1e-11	BLAST
low complexity region	821	832	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000108160

SMART Domains

Protein: ENSMUSP00000103795
Gene: ENSMUSG00000018845

Domain	Start	End	E-Value	Type
TPR	6	39	1.02e1	SMART
TPR	43	76	7.47e0	SMART
TPR	77	110	2.52e-1	SMART
Blast:ARM	167	208	3e-16	BLAST
Blast:ARM	210	250	1e-10	BLAST
Pfam:UNC45-central	271	489	2.2e-52	PFAM
Blast:ARM	663	703	2e-14	BLAST
Blast:ARM	706	748	5e-11	BLAST
Blast:ARM	749	790	1e-20	BLAST
Blast:ARM	791	822	1e-11	BLAST
low complexity region	823	834	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000108160

SMART Domains

Protein: ENSMUSP00000103795
Gene: ENSMUSG00000018845

Domain	Start	End	E-Value	Type
TPR	6	39	1.02e1	SMART
TPR	43	76	7.47e0	SMART
TPR	77	110	2.52e-1	SMART
Blast:ARM	167	208	3e-16	BLAST
Blast:ARM	210	250	1e-10	BLAST
Pfam:UNC45-central	271	489	2.2e-52	PFAM
Blast:ARM	663	703	2e-14	BLAST
Blast:ARM	706	748	5e-11	BLAST
Blast:ARM	749	790	1e-20	BLAST
Blast:ARM	791	822	1e-11	BLAST
low complexity region	823	834	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142336

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156395

Predicted Effect

probably null
Transcript: ENSMUST00000164945

SMART Domains

Protein: ENSMUSP00000129405
Gene: ENSMUSG00000018845

Domain	Start	End	E-Value	Type
TPR	6	39	1.02e1	SMART
TPR	43	76	7.47e0	SMART
TPR	77	110	2.52e-1	SMART
Blast:ARM	167	208	3e-16	BLAST
Blast:ARM	210	250	1e-10	BLAST
Pfam:UNC45-central	298	489	1.7e-41	PFAM
Blast:ARM	663	703	2e-14	BLAST
Blast:ARM	706	748	5e-11	BLAST
Blast:ARM	749	790	1e-20	BLAST
Blast:ARM	791	822	1e-11	BLAST
low complexity region	823	834	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000164945

SMART Domains

Protein: ENSMUSP00000129405
Gene: ENSMUSG00000018845

Domain	Start	End	E-Value	Type
TPR	6	39	1.02e1	SMART
TPR	43	76	7.47e0	SMART
TPR	77	110	2.52e-1	SMART
Blast:ARM	167	208	3e-16	BLAST
Blast:ARM	210	250	1e-10	BLAST
Pfam:UNC45-central	298	489	1.7e-41	PFAM
Blast:ARM	663	703	2e-14	BLAST
Blast:ARM	706	748	5e-11	BLAST
Blast:ARM	749	790	1e-20	BLAST
Blast:ARM	791	822	1e-11	BLAST
low complexity region	823	834	N/A	INTRINSIC

Meta Mutation Damage Score

0.9492

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 94.9%

Validation Efficiency

99% (87/88)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a co-chaperone required for folding and accumulation of type II myosins. The protein consists of three tetratricopeptide repeat motifs at the N-terminus that form a complex with heat shock protein 90, a central region of unknown function that is conserved in all Unc-45 proteins, and a C-terminal Unc-45/Cro1/She4 domain. The protein is expressed at high levels in striated muscle, where its muscle myosin chaperone activity is dependent on heat shock protein 90 acting as a co-chaperone. A missense mutation in this gene has been associated with cataract development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E9 without placental abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610021A01Rik	A	G	7: 41,625,838	T322A	probably benign	Het
Abhd13	C	T	8: 9,988,071	P223S	possibly damaging	Het
Adgra3	T	A	5: 49,960,563	L1214F	probably damaging	Het
Alkbh2	C	T	5: 114,124,226	E148K	probably damaging	Het
Ankrd13a	C	A	5: 114,789,312	P120Q	probably damaging	Het
Apbb1ip	A	G	2: 22,849,544	Y277C	probably damaging	Het
Arfgap1	T	C	2: 180,976,373		probably benign	Het
Arid2	T	A	15: 96,392,462	V1746D	probably damaging	Het
C1qtnf7	T	A	5: 43,609,207	N49K	possibly damaging	Het
Cacnb2	A	T	2: 14,986,000	D587V	possibly damaging	Het
Ccar2	A	T	14: 70,151,910		probably null	Het
Cdk2ap2	T	C	19: 4,097,879	F49L	possibly damaging	Het
Cdon	A	T	9: 35,476,969	I747F	probably damaging	Het
Cyp19a1	G	A	9: 54,193,323	P27S	probably benign	Het
Cyp4v3	T	A	8: 45,306,992	R508W	probably damaging	Het
Dclk1	T	C	3: 55,247,410	L87P	probably damaging	Het
Ddx41	G	A	13: 55,536,021	R66C	possibly damaging	Het
Dmxl1	T	C	18: 49,852,360	Y225H	probably damaging	Het
Dnah7a	G	A	1: 53,411,659	P3871S	probably benign	Het
Dnhd1	A	G	7: 105,657,166		probably null	Het
Dph1	A	T	11: 75,178,895		probably benign	Het
Egln2	A	G	7: 27,159,583	I382T	probably damaging	Het
Enpp3	A	G	10: 24,776,882	Y726H	probably damaging	Het
Fbxo32	A	G	15: 58,181,477	F353L	probably damaging	Het
Fchsd2	G	A	7: 101,277,602	G657D	possibly damaging	Het
Fer1l4	T	A	2: 156,036,639	E44V	possibly damaging	Het
Gjb2	C	T	14: 57,100,305	V149I	probably benign	Het
Glipr1l1	A	G	10: 112,062,412	M141V	probably benign	Het
Gnaq	T	C	19: 16,335,006	S211P	probably damaging	Het
Gnl1	A	G	17: 35,988,250	R527G	probably benign	Het
Gns	A	G	10: 121,381,178	Q286R	probably benign	Het
Gon4l	T	C	3: 88,910,090		probably benign	Het
Gpr107	T	C	2: 31,207,665		probably benign	Het
Gprasp1	C	T	X: 135,802,843	R1262C	probably damaging	Het
Gtf2ird1	A	T	5: 134,411,003	D124E	probably damaging	Het
Hbp1	T	A	12: 31,950,232		probably benign	Het
Hrnr	C	T	3: 93,323,568	T371I	unknown	Het
Ints2	A	G	11: 86,256,198	C41R	probably damaging	Het
Jhy	A	G	9: 40,911,093	I583T	probably benign	Het
Jph4	G	T	14: 55,115,046	R77S	probably damaging	Het
Kcnd3	C	T	3: 105,658,766	A421V	probably damaging	Het
Klhl12	A	T	1: 134,485,769	I331F	probably benign	Het
Map4k4	G	A	1: 40,000,538	R30Q	probably damaging	Het
Mettl11b	T	A	1: 163,703,017	*284C	probably null	Het
Mgst1	C	A	6: 138,156,215	T176K	probably damaging	Het
Negr1	C	A	3: 157,208,376		probably benign	Het
Nrg1	C	T	8: 31,917,774	V144I	probably benign	Het
Olfr51	T	C	11: 51,007,554	I194T	possibly damaging	Het
Otog	A	G	7: 46,310,147	D720G	probably damaging	Het
Pex11b	A	T	3: 96,644,014		probably benign	Het
Phtf2	T	C	5: 20,789,595		probably benign	Het
Ppip5k1	C	T	2: 121,343,563	R359Q	possibly damaging	Het
Prickle2	T	C	6: 92,422,342	I185V	probably benign	Het
Prrc2a	G	A	17: 35,158,497	P562S	unknown	Het
Rdx	A	G	9: 52,068,841	I245V	probably benign	Het
Rem2	T	C	14: 54,477,659	S98P	probably damaging	Het
Rhob	T	G	12: 8,499,373	D87A	probably damaging	Het
Ros1	T	A	10: 52,163,994	E300D	probably damaging	Het
Sbf2	A	G	7: 110,348,853		probably null	Het
Sipa1l3	G	T	7: 29,325,862	P619Q	probably damaging	Het
Snupn	A	G	9: 56,978,062	E217G	probably benign	Het
Ston2	T	A	12: 91,639,722	*896C	probably null	Het
Stradb	C	T	1: 58,979,958	R13*	probably null	Het
Tbx21	G	A	11: 97,114,755	A128V	probably benign	Het
Tep1	A	T	14: 50,824,740	C2552S	probably benign	Het
Tgif1	A	T	17: 70,844,917	V233E	possibly damaging	Het
Trim31	A	T	17: 36,898,741	I130L	probably benign	Het
Trrap	C	T	5: 144,792,118	T614I	probably benign	Het
Ttn	C	A	2: 76,936,414	V3107F	probably damaging	Het
Txnrd2	T	G	16: 18,456,206	D322E	probably benign	Het
Usp43	A	T	11: 67,875,352	L744*	probably null	Het
Usp43	C	T	11: 67,898,962	C252Y	probably damaging	Het
Vmn2r71	A	C	7: 85,624,194	K739Q	possibly damaging	Het
Vps16	C	T	2: 130,442,204	T653M	probably benign	Het
Wdr83os	T	A	8: 85,081,866	S82R	probably damaging	Het
Xpo6	T	A	7: 126,128,255	L526F	probably damaging	Het
Zfhx4	G	A	3: 5,401,834	V2351I	probably benign	Het
Zfp558	A	T	9: 18,456,503	C330S	possibly damaging	Het

Other mutations in Unc45b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01320:Unc45b	APN	11	82912393	critical splice acceptor site	probably null
IGL01983:Unc45b	APN	11	82936861	missense	probably benign
IGL02083:Unc45b	APN	11	82922919	missense	probably damaging	0.96
IGL02159:Unc45b	APN	11	82940181	splice site	probably benign
IGL02160:Unc45b	APN	11	82940181	splice site	probably benign
IGL02165:Unc45b	APN	11	82940181	splice site	probably benign
IGL02166:Unc45b	APN	11	82940181	splice site	probably benign
IGL02986:Unc45b	APN	11	82917179	missense	probably damaging	0.98
fife	UTSW	11	82936852	missense	probably benign	0.00
R0195:Unc45b	UTSW	11	82937828	missense	probably damaging	1.00
R0197:Unc45b	UTSW	11	82940205	missense	possibly damaging	0.78
R0218:Unc45b	UTSW	11	82911860	splice site	probably benign
R0436:Unc45b	UTSW	11	82929567	splice site	probably benign
R0569:Unc45b	UTSW	11	82936812	splice site	probably benign
R0701:Unc45b	UTSW	11	82940205	missense	possibly damaging	0.78
R0883:Unc45b	UTSW	11	82940205	missense	possibly damaging	0.78
R1146:Unc45b	UTSW	11	82922907	missense	probably damaging	0.99
R1146:Unc45b	UTSW	11	82922907	missense	probably damaging	0.99
R1378:Unc45b	UTSW	11	82936852	missense	probably benign	0.00
R1446:Unc45b	UTSW	11	82928670	missense	probably damaging	1.00
R1532:Unc45b	UTSW	11	82936874	missense	probably benign	0.12
R1559:Unc45b	UTSW	11	82917846	missense	possibly damaging	0.66
R1582:Unc45b	UTSW	11	82925945	missense	probably benign	0.30
R1628:Unc45b	UTSW	11	82929380	splice site	probably null
R1666:Unc45b	UTSW	11	82917739	missense	probably benign	0.31
R1677:Unc45b	UTSW	11	82911705	splice site	probably null
R1759:Unc45b	UTSW	11	82929499	missense	probably benign	0.33
R1909:Unc45b	UTSW	11	82926087	missense	probably damaging	1.00
R2067:Unc45b	UTSW	11	82911689	missense	probably benign	0.01
R2111:Unc45b	UTSW	11	82911689	missense	probably benign	0.01
R2145:Unc45b	UTSW	11	82917754	missense	probably benign	0.30
R2258:Unc45b	UTSW	11	82917799	missense	probably benign	0.01
R2259:Unc45b	UTSW	11	82917799	missense	probably benign	0.01
R2497:Unc45b	UTSW	11	82936443	missense	probably damaging	1.00
R2507:Unc45b	UTSW	11	82940137	splice site	probably null
R4352:Unc45b	UTSW	11	82913209	missense	probably damaging	0.99
R4624:Unc45b	UTSW	11	82926009	missense	probably benign	0.30
R5236:Unc45b	UTSW	11	82915062	missense	possibly damaging	0.53
R5512:Unc45b	UTSW	11	82915072	missense	possibly damaging	0.47
R5688:Unc45b	UTSW	11	82922817	missense	possibly damaging	0.88
R6029:Unc45b	UTSW	11	82913327	missense	probably damaging	1.00
R6616:Unc45b	UTSW	11	82911819	missense	probably damaging	1.00
R6857:Unc45b	UTSW	11	82913212	missense	probably benign	0.00
R6876:Unc45b	UTSW	11	82922912	missense	probably benign	0.00
R7197:Unc45b	UTSW	11	82940187	critical splice acceptor site	probably null
R7368:Unc45b	UTSW	11	82942495	missense	probably benign	0.01
R7531:Unc45b	UTSW	11	82929012	missense	probably damaging	1.00
R7743:Unc45b	UTSW	11	82922900	missense	probably damaging	1.00
R8198:Unc45b	UTSW	11	82925988	frame shift	probably null
R8214:Unc45b	UTSW	11	82933888	missense	possibly damaging	0.50
R8235:Unc45b	UTSW	11	82919855	missense	probably benign	0.01
R8916:Unc45b	UTSW	11	82913212	missense	probably benign	0.00
R9004:Unc45b	UTSW	11	82928689	missense	probably damaging	1.00
R9521:Unc45b	UTSW	11	82917760	missense	probably benign	0.09
R9687:Unc45b	UTSW	11	82919736	missense	probably damaging	1.00
R9757:Unc45b	UTSW	11	82919732	missense	probably damaging	0.99
R9784:Unc45b	UTSW	11	82926160	missense	probably damaging	1.00
T0970:Unc45b	UTSW	11	82922888	missense	probably benign	0.00
Z1176:Unc45b	UTSW	11	82928654	critical splice acceptor site	probably null
Z1176:Unc45b	UTSW	11	82942715	missense	probably damaging	1.00
Z1177:Unc45b	UTSW	11	82942553	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAAGGAACAGGTCTCTGGGC -3'
(R):5'- AGCTGAATTTCTAGGAGCACAATTG -3'

Sequencing Primer
(F):5'- CTGTGGATCTCTGATTAGACAGACAG -3'
(R):5'- TTGTGATCACTAGAGGTAGAGCC -3'

Posted On

2015-09-24