Incidental Mutation 'R4566:Rasl2-9'
ID343319
Institutional Source Beutler Lab
Gene Symbol Rasl2-9
Ensembl Gene ENSMUSG00000083649
Gene NameRAS-like, family 2, locus 9
SynonymsRasl2-9-ps, Ran/M2
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.917) question?
Stock #R4566 (G1)
Quality Score217
Status Not validated
Chromosome7
Chromosomal Location5124938-5125950 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) AGG to A at 5125375 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000129559 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000147835]
Predicted Effect probably null
Transcript: ENSMUST00000147835
SMART Domains Protein: ENSMUSP00000129559
Gene: ENSMUSG00000083649

DomainStartEndE-ValueType
RAN 16 216 1.25e-161 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175212
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207732
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 T C 13: 81,419,808 E5082G probably damaging Het
Apol7a A T 15: 77,389,751 Y170* probably null Het
Cfhr1 T A 1: 139,553,648 I165F possibly damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Espnl C A 1: 91,344,579 P510T possibly damaging Het
Fbxw4 A G 19: 45,591,786 V258A probably benign Het
Foxq1 T C 13: 31,559,488 M191T probably benign Het
Gabrg1 A T 5: 70,842,141 L22I probably benign Het
Limk1 A G 5: 134,686,683 L38P probably benign Het
Mfhas1 C T 8: 35,591,049 R893C probably damaging Het
Mug2 G A 6: 122,079,638 V1181I probably benign Het
Olfr655 A T 7: 104,596,616 C188* probably null Het
Pithd1 A G 4: 135,977,237 V56A probably damaging Het
Plxna4 T C 6: 32,517,403 K93E probably benign Het
Ppp2cb T C 8: 33,610,695 V48A possibly damaging Het
Rrs1 T C 1: 9,546,227 F235S probably damaging Het
Rtl1 G A 12: 109,592,859 L849F probably damaging Het
Slc5a9 C A 4: 111,891,744 probably null Het
Trps1 A G 15: 50,831,678 V116A probably damaging Het
Vmn2r51 C T 7: 10,102,414 E147K probably benign Het
Yy1 T A 12: 108,812,963 I296K probably damaging Het
Other mutations in Rasl2-9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02110:Rasl2-9 APN 7 5125347 missense probably benign 0.00
R1500:Rasl2-9 UTSW 7 5125442 nonsense probably null
R4567:Rasl2-9 UTSW 7 5125375 frame shift probably null
R4568:Rasl2-9 UTSW 7 5125375 frame shift probably null
R4745:Rasl2-9 UTSW 7 5125703 missense possibly damaging 0.90
R7301:Rasl2-9 UTSW 7 5125740 missense probably damaging 1.00
R8025:Rasl2-9 UTSW 7 5125482 missense probably damaging 1.00
R8281:Rasl2-9 UTSW 7 5125352 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGAATTGCACGATCTCCTTTAGC -3'
(R):5'- TCCCCATTGTATTGTGTGGC -3'

Sequencing Primer
(F):5'- CTCCTTTAGCTAAATAAGGTGGCAC -3'
(R):5'- GGCAACAAAGTGGATGTTAAAGAC -3'
Posted On2015-09-24