Mutagenetix > Incidental Mutation

Incidental Mutation 'R0058:Ache'

34332

Institutional Source

Beutler Lab

Gene Symbol

Ache

Ensembl Gene

ENSMUSG00000023328

Gene Name

acetylcholinesterase

Synonyms

MMRRC Submission

038352-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.785) question?

Stock #

R0058 (G1)

Quality Score

134

Status

Validated

Chromosome

Chromosomal Location

137287519-137294466 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 137290842 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glycine at position 270 (V270G)

Ref Sequence

ENSEMBL: ENSMUSP00000083097 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024099] [ENSMUST00000040873] [ENSMUST00000052825] [ENSMUST00000085934] [ENSMUST00000125195] [ENSMUST00000132191] [ENSMUST00000137126] [ENSMUST00000138591] [ENSMUST00000141123] [ENSMUST00000196109] [ENSMUST00000196208] [ENSMUST00000198526] [ENSMUST00000197466] [ENSMUST00000199243]

AlphaFold

P21836

Predicted Effect

probably damaging
Transcript: ENSMUST00000024099
AA Change: V270G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000024099
Gene: ENSMUSG00000023328
AA Change: V270G

Domain	Start	End	E-Value	Type
Pfam:COesterase	14	563	2e-186	PFAM
Pfam:Abhydrolase_3	146	276	7.5e-9	PFAM
Pfam:AChE_tetra	578	614	3.2e-26	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000040873

SMART Domains

Protein: ENSMUSP00000043123
Gene: ENSMUSG00000037364

Domain	Start	End	E-Value	Type
low complexity region	3	65	N/A	INTRINSIC
low complexity region	95	116	N/A	INTRINSIC
Pfam:DUF3546	153	262	3.8e-44	PFAM
low complexity region	269	276	N/A	INTRINSIC
low complexity region	326	350	N/A	INTRINSIC
coiled coil region	367	402	N/A	INTRINSIC
Blast:RRM	421	491	2e-31	BLAST
low complexity region	566	595	N/A	INTRINSIC
low complexity region	603	615	N/A	INTRINSIC
Pfam:ARS2	645	850	9.7e-94	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000052825

SMART Domains

Protein: ENSMUSP00000056156
Gene: ENSMUSG00000051502

Domain	Start	End	E-Value	Type
Pfam:Peptidase_C78	27	212	5.4e-37	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000085934
AA Change: V270G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000083097
Gene: ENSMUSG00000023328
AA Change: V270G

Domain	Start	End	E-Value	Type
Pfam:COesterase	15	563	3e-178	PFAM
Pfam:Abhydrolase_3	146	260	1.4e-7	PFAM
Pfam:AChE_tetra	578	613	3.2e-23	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000125195

Predicted Effect

probably benign
Transcript: ENSMUST00000132191

Predicted Effect

probably benign
Transcript: ENSMUST00000137126

Predicted Effect

probably benign
Transcript: ENSMUST00000138591

Predicted Effect

probably benign
Transcript: ENSMUST00000141123

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150983

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000184134

Predicted Effect

probably benign
Transcript: ENSMUST00000196109

SMART Domains

Protein: ENSMUSP00000142351
Gene: ENSMUSG00000037364

Domain	Start	End	E-Value	Type
coiled coil region	11	46	N/A	INTRINSIC
Blast:RRM	65	133	2e-15	BLAST
low complexity region	208	237	N/A	INTRINSIC
low complexity region	245	257	N/A	INTRINSIC
Pfam:ARS2	277	498	6.5e-111	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000196208
AA Change: V270G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000142427
Gene: ENSMUSG00000023328
AA Change: V270G

Domain	Start	End	E-Value	Type
Pfam:COesterase	14	359	6.5e-134	PFAM
Pfam:Abhydrolase_3	146	284	4.1e-7	PFAM
Pfam:COesterase	355	475	1.5e-25	PFAM
Pfam:AChE_tetra	490	526	2.2e-23	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000196840

Predicted Effect

probably benign
Transcript: ENSMUST00000198526

SMART Domains

Protein: ENSMUSP00000142435
Gene: ENSMUSG00000037364

Domain	Start	End	E-Value	Type
low complexity region	3	65	N/A	INTRINSIC
low complexity region	95	116	N/A	INTRINSIC
Pfam:DUF3546	151	264	2e-45	PFAM
low complexity region	269	276	N/A	INTRINSIC
low complexity region	322	347	N/A	INTRINSIC
low complexity region	369	408	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000197466

SMART Domains

Protein: ENSMUSP00000142564
Gene: ENSMUSG00000037364

Domain	Start	End	E-Value	Type
low complexity region	3	65	N/A	INTRINSIC
low complexity region	95	116	N/A	INTRINSIC
Pfam:DUF3546	151	264	9.5e-48	PFAM
low complexity region	269	276	N/A	INTRINSIC
low complexity region	326	350	N/A	INTRINSIC
coiled coil region	367	402	N/A	INTRINSIC
Blast:RRM	421	491	2e-31	BLAST
low complexity region	566	595	N/A	INTRINSIC
low complexity region	603	615	N/A	INTRINSIC
Pfam:ARS2	635	845	5.5e-113	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000199243

SMART Domains

Protein: ENSMUSP00000143232
Gene: ENSMUSG00000037364

Domain	Start	End	E-Value	Type
low complexity region	3	65	N/A	INTRINSIC
low complexity region	95	116	N/A	INTRINSIC
Pfam:DUF3546	151	264	9.5e-48	PFAM
low complexity region	269	276	N/A	INTRINSIC
low complexity region	326	350	N/A	INTRINSIC
coiled coil region	367	402	N/A	INTRINSIC
Blast:RRM	421	491	2e-31	BLAST
low complexity region	566	595	N/A	INTRINSIC
low complexity region	603	615	N/A	INTRINSIC
Pfam:ARS2	635	849	9.8e-115	PFAM

Meta Mutation Damage Score

0.5707

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.0%
20x: 94.8%

Validation Efficiency

100% (74/74)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acetylcholinesterase hydrolyzes the neurotransmitter, acetylcholine at neuromuscular junctions and brain cholinergic synapses, and thus terminates signal transmission. It is also found on the red blood cell membranes, where it constitutes the Yt blood group antigen. Acetylcholinesterase exists in multiple molecular forms which possess similar catalytic properties, but differ in their oligomeric assembly and mode of cell attachment to the cell surface. It is encoded by the single ACHE gene, and the structural diversity in the gene products arises from alternative mRNA splicing, and post-translational associations of catalytic and structural subunits. The major form of acetylcholinesterase found in brain, muscle and other tissues is the hydrophilic species, which forms disulfide-linked oligomers with collagenous, or lipid-containing structural subunits. The other, alternatively spliced form, expressed primarily in the erythroid tissues, differs at the C-terminal end, and contains a cleavable hydrophobic peptide with a GPI-anchor site. It associates with the membranes through the phosphoinositide (PI) moieties added post-translationally. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants show retarded postnatal development, tremors, impaired righting response, delayed maturation of external ear, failure of eyelids to open, and die by 3-wk. of age. Mutants are highly sensitive to butyrylcholinesterase inhibitor toxicity. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acss1	A	T	2: 150,628,539	W394R	probably damaging	Het
Adgrv1	A	G	13: 81,182,672	V6088A	possibly damaging	Het
Ankrd36	A	G	11: 5,630,691		probably benign	Het
Anxa1	A	T	19: 20,383,777	Y84N	probably damaging	Het
Arnt2	G	A	7: 84,347,530	R63C	probably damaging	Het
Avpr1b	A	G	1: 131,599,786	T16A	probably benign	Het
Bpifb1	G	A	2: 154,206,540	R165H	possibly damaging	Het
Cables1	A	G	18: 11,923,413	E316G	possibly damaging	Het
Cadm1	A	T	9: 47,850,331	I427L	probably damaging	Het
Ccdc97	T	C	7: 25,715,980	D86G	probably benign	Het
Cgnl1	C	A	9: 71,641,397	D1081Y	probably damaging	Het
Cgnl1	T	A	9: 71,724,840	R410W	probably damaging	Het
Cntnap4	G	A	8: 112,785,784	E593K	probably damaging	Het
Dazap1	T	C	10: 80,261,581		probably benign	Het
Dip2b	A	G	15: 100,215,240	E1512G	probably benign	Het
Dock1	G	A	7: 135,108,761	V1171M	possibly damaging	Het
Dock5	A	T	14: 67,781,036	F1230Y	probably benign	Het
Dym	G	A	18: 75,043,172	E15K	possibly damaging	Het
Ednra	C	A	8: 77,667,322		probably null	Het
Faf1	A	G	4: 109,736,624	Q133R	probably benign	Het
Fbxw28	A	G	9: 109,328,211	I323T	probably benign	Het
Fcer2a	T	C	8: 3,688,111		probably benign	Het
Fmo2	A	T	1: 162,886,324	S204R	probably benign	Het
Frmd4b	A	G	6: 97,423,499	V63A	probably damaging	Het
Fzd8	G	A	18: 9,213,985	A356T	possibly damaging	Het
Ghitm	A	G	14: 37,131,592	L97P	probably damaging	Het
Gins4	A	G	8: 23,229,510		probably benign	Het
Golga3	T	A	5: 110,202,777	F766Y	possibly damaging	Het
Hapln1	T	C	13: 89,607,878	I267T	probably benign	Het
Helz	A	T	11: 107,672,558		probably benign	Het
Herc2	T	C	7: 56,170,483	V2851A	possibly damaging	Het
Igkv8-18	G	A	6: 70,356,121		probably benign	Het
Igll1	A	T	16: 16,863,876	V5E	probably benign	Het
Irx3	T	C	8: 91,800,540	T179A	possibly damaging	Het
Kif16b	A	G	2: 142,857,305		probably null	Het
Limk1	A	T	5: 134,659,871	W507R	probably damaging	Het
Marf1	C	T	16: 14,142,534	A549T	probably damaging	Het
Mtif3	C	A	5: 146,956,921	V159F	probably benign	Het
Myh6	C	T	14: 54,963,404	R169Q	probably damaging	Het
Ncoa7	T	A	10: 30,647,541	D887V	probably damaging	Het
Obox7	C	T	7: 14,664,388	P76S	probably benign	Het
Olfr1335	A	G	4: 118,809,480	M128T	probably benign	Het
Olfr323	A	T	11: 58,625,668	I126N	probably damaging	Het
Pitpnm2	G	A	5: 124,124,030	A862V	probably damaging	Het
Pkd1	G	C	17: 24,564,703	A162P	probably benign	Het
Plce1	A	G	19: 38,525,184	D309G	possibly damaging	Het
Plk4	T	C	3: 40,805,872	V401A	probably benign	Het
Prdx3	T	C	19: 60,874,512		probably benign	Het
Prrc2c	C	T	1: 162,698,884	V253I	unknown	Het
Ranbp2	T	A	10: 58,480,531	S2358T	probably damaging	Het
Setd2	T	A	9: 110,594,426	V2183E	probably damaging	Het
Sgsm1	T	A	5: 113,285,087	S232C	probably damaging	Het
Skint6	A	T	4: 113,046,815		probably benign	Het
Slc15a2	A	G	16: 36,754,547	I531T	probably benign	Het
Slc36a1	C	T	11: 55,221,994		probably benign	Het
Sorbs2	C	A	8: 45,796,263	D831E	probably damaging	Het
Sorbs2	T	A	8: 45,785,254		probably null	Het
Sptan1	T	C	2: 29,993,696		probably null	Het
Stam	T	C	2: 14,138,141	C336R	probably damaging	Het
Stil	G	T	4: 115,041,298	A1042S	probably damaging	Het
Stxbp5l	T	A	16: 37,142,374	D773V	possibly damaging	Het
Sugct	A	T	13: 17,672,581	L39Q	probably damaging	Het
Tep1	A	G	14: 50,834,065	V2041A	possibly damaging	Het
Tex15	C	T	8: 33,581,502		probably benign	Het
Tlr9	T	G	9: 106,224,965	L485R	possibly damaging	Het
Tmem207	A	G	16: 26,524,829		probably benign	Het
Triml2	T	C	8: 43,185,269		probably benign	Het
Trip6	A	G	5: 137,310,845		probably benign	Het
Tspear	T	C	10: 77,869,631	F288L	probably benign	Het
Vmn1r179	C	T	7: 23,929,167	T261I	possibly damaging	Het
Zfp644	A	T	5: 106,637,003	S559R	possibly damaging	Het

Other mutations in Ache

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02323:Ache	APN	5	137291064	missense	probably damaging	1.00
IGL02833:Ache	APN	5	137291109	unclassified	probably benign
R0358:Ache	UTSW	5	137290373	missense	probably benign	0.21
R0377:Ache	UTSW	5	137290928	missense	possibly damaging	0.54
R0780:Ache	UTSW	5	137290532	missense	probably damaging	1.00
R1233:Ache	UTSW	5	137290157	splice site	probably null
R1702:Ache	UTSW	5	137290989	missense	possibly damaging	0.94
R1762:Ache	UTSW	5	137290575	missense	possibly damaging	0.91
R4191:Ache	UTSW	5	137291072	missense	probably damaging	0.98
R4226:Ache	UTSW	5	137290890	missense	possibly damaging	0.83
R4499:Ache	UTSW	5	137291932	missense	probably damaging	0.98
R4931:Ache	UTSW	5	137291914	missense	probably benign	0.00
R5411:Ache	UTSW	5	137290064	missense	possibly damaging	0.93
R5411:Ache	UTSW	5	137290430	splice site	probably null
R5698:Ache	UTSW	5	137290559	missense	probably damaging	1.00
R6153:Ache	UTSW	5	137291855	missense	probably damaging	1.00
R6526:Ache	UTSW	5	137290644	missense	probably damaging	1.00
R6896:Ache	UTSW	5	137291734	missense	probably damaging	0.98
R6981:Ache	UTSW	5	137291678	missense	probably benign
R7199:Ache	UTSW	5	137290242	missense	probably damaging	1.00
R7208:Ache	UTSW	5	137291489	missense	probably damaging	1.00
R8200:Ache	UTSW	5	137294195	missense	probably damaging	1.00
R8338:Ache	UTSW	5	137291744	missense	probably damaging	1.00
R8461:Ache	UTSW	5	137290320	missense	probably damaging	0.96
R8933:Ache	UTSW	5	137290187	missense	possibly damaging	0.56
R9146:Ache	UTSW	5	137290815	missense	probably damaging	1.00
R9376:Ache	UTSW	5	137290763	missense	probably benign
R9439:Ache	UTSW	5	137290923	missense	probably damaging	0.97
X0061:Ache	UTSW	5	137290095	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATCAACGGCTTGCCTTGCAATG -3'
(R):5'- AGGACTGATTTTGGGACCCACAAAC -3'

Sequencing Primer
(F):5'- CTTGCCTTGCAATGGGTGC -3'
(R):5'- GGATCTGTAGTAAGCCCTCATGC -3'

Posted On

2013-05-09