Incidental Mutation 'R0058:Ache'
ID 34332
Institutional Source Beutler Lab
Gene Symbol Ache
Ensembl Gene ENSMUSG00000023328
Gene Name acetylcholinesterase
Synonyms
MMRRC Submission 038352-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.683) question?
Stock # R0058 (G1)
Quality Score 134
Status Validated
Chromosome 5
Chromosomal Location 137286516-137292728 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 137289104 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glycine at position 270 (V270G)
Ref Sequence ENSEMBL: ENSMUSP00000083097 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024099] [ENSMUST00000040873] [ENSMUST00000052825] [ENSMUST00000085934] [ENSMUST00000125195] [ENSMUST00000132191] [ENSMUST00000137126] [ENSMUST00000138591] [ENSMUST00000141123] [ENSMUST00000196208] [ENSMUST00000198526] [ENSMUST00000197466] [ENSMUST00000196109] [ENSMUST00000199243]
AlphaFold P21836
Predicted Effect probably damaging
Transcript: ENSMUST00000024099
AA Change: V270G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000024099
Gene: ENSMUSG00000023328
AA Change: V270G

DomainStartEndE-ValueType
Pfam:COesterase 14 563 2e-186 PFAM
Pfam:Abhydrolase_3 146 276 7.5e-9 PFAM
Pfam:AChE_tetra 578 614 3.2e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000040873
SMART Domains Protein: ENSMUSP00000043123
Gene: ENSMUSG00000037364

DomainStartEndE-ValueType
low complexity region 3 65 N/A INTRINSIC
low complexity region 95 116 N/A INTRINSIC
Pfam:DUF3546 153 262 3.8e-44 PFAM
low complexity region 269 276 N/A INTRINSIC
low complexity region 326 350 N/A INTRINSIC
coiled coil region 367 402 N/A INTRINSIC
Blast:RRM 421 491 2e-31 BLAST
low complexity region 566 595 N/A INTRINSIC
low complexity region 603 615 N/A INTRINSIC
Pfam:ARS2 645 850 9.7e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000052825
SMART Domains Protein: ENSMUSP00000056156
Gene: ENSMUSG00000051502

DomainStartEndE-ValueType
Pfam:Peptidase_C78 27 212 5.4e-37 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000085934
AA Change: V270G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000083097
Gene: ENSMUSG00000023328
AA Change: V270G

DomainStartEndE-ValueType
Pfam:COesterase 15 563 3e-178 PFAM
Pfam:Abhydrolase_3 146 260 1.4e-7 PFAM
Pfam:AChE_tetra 578 613 3.2e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125195
Predicted Effect probably benign
Transcript: ENSMUST00000132191
Predicted Effect probably benign
Transcript: ENSMUST00000137126
Predicted Effect probably benign
Transcript: ENSMUST00000138591
Predicted Effect probably benign
Transcript: ENSMUST00000141123
Predicted Effect probably damaging
Transcript: ENSMUST00000196208
AA Change: V270G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000142427
Gene: ENSMUSG00000023328
AA Change: V270G

DomainStartEndE-ValueType
Pfam:COesterase 14 359 6.5e-134 PFAM
Pfam:Abhydrolase_3 146 284 4.1e-7 PFAM
Pfam:COesterase 355 475 1.5e-25 PFAM
Pfam:AChE_tetra 490 526 2.2e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150983
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184134
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196840
Predicted Effect probably benign
Transcript: ENSMUST00000198526
SMART Domains Protein: ENSMUSP00000142435
Gene: ENSMUSG00000037364

DomainStartEndE-ValueType
low complexity region 3 65 N/A INTRINSIC
low complexity region 95 116 N/A INTRINSIC
Pfam:DUF3546 151 264 2e-45 PFAM
low complexity region 269 276 N/A INTRINSIC
low complexity region 322 347 N/A INTRINSIC
low complexity region 369 408 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197466
SMART Domains Protein: ENSMUSP00000142564
Gene: ENSMUSG00000037364

DomainStartEndE-ValueType
low complexity region 3 65 N/A INTRINSIC
low complexity region 95 116 N/A INTRINSIC
Pfam:DUF3546 151 264 9.5e-48 PFAM
low complexity region 269 276 N/A INTRINSIC
low complexity region 326 350 N/A INTRINSIC
coiled coil region 367 402 N/A INTRINSIC
Blast:RRM 421 491 2e-31 BLAST
low complexity region 566 595 N/A INTRINSIC
low complexity region 603 615 N/A INTRINSIC
Pfam:ARS2 635 845 5.5e-113 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196109
SMART Domains Protein: ENSMUSP00000142351
Gene: ENSMUSG00000037364

DomainStartEndE-ValueType
coiled coil region 11 46 N/A INTRINSIC
Blast:RRM 65 133 2e-15 BLAST
low complexity region 208 237 N/A INTRINSIC
low complexity region 245 257 N/A INTRINSIC
Pfam:ARS2 277 498 6.5e-111 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199243
SMART Domains Protein: ENSMUSP00000143232
Gene: ENSMUSG00000037364

DomainStartEndE-ValueType
low complexity region 3 65 N/A INTRINSIC
low complexity region 95 116 N/A INTRINSIC
Pfam:DUF3546 151 264 9.5e-48 PFAM
low complexity region 269 276 N/A INTRINSIC
low complexity region 326 350 N/A INTRINSIC
coiled coil region 367 402 N/A INTRINSIC
Blast:RRM 421 491 2e-31 BLAST
low complexity region 566 595 N/A INTRINSIC
low complexity region 603 615 N/A INTRINSIC
Pfam:ARS2 635 849 9.8e-115 PFAM
Meta Mutation Damage Score 0.5707 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acetylcholinesterase hydrolyzes the neurotransmitter, acetylcholine at neuromuscular junctions and brain cholinergic synapses, and thus terminates signal transmission. It is also found on the red blood cell membranes, where it constitutes the Yt blood group antigen. Acetylcholinesterase exists in multiple molecular forms which possess similar catalytic properties, but differ in their oligomeric assembly and mode of cell attachment to the cell surface. It is encoded by the single ACHE gene, and the structural diversity in the gene products arises from alternative mRNA splicing, and post-translational associations of catalytic and structural subunits. The major form of acetylcholinesterase found in brain, muscle and other tissues is the hydrophilic species, which forms disulfide-linked oligomers with collagenous, or lipid-containing structural subunits. The other, alternatively spliced form, expressed primarily in the erythroid tissues, differs at the C-terminal end, and contains a cleavable hydrophobic peptide with a GPI-anchor site. It associates with the membranes through the phosphoinositide (PI) moieties added post-translationally. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants show retarded postnatal development, tremors, impaired righting response, delayed maturation of external ear, failure of eyelids to open, and die by 3-wk. of age. Mutants are highly sensitive to butyrylcholinesterase inhibitor toxicity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss1 A T 2: 150,470,459 (GRCm39) W394R probably damaging Het
Adgrv1 A G 13: 81,330,791 (GRCm39) V6088A possibly damaging Het
Ankrd36 A G 11: 5,580,691 (GRCm39) probably benign Het
Anxa1 A T 19: 20,361,141 (GRCm39) Y84N probably damaging Het
Arnt2 G A 7: 83,996,738 (GRCm39) R63C probably damaging Het
Avpr1b A G 1: 131,527,524 (GRCm39) T16A probably benign Het
Bpifb1 G A 2: 154,048,460 (GRCm39) R165H possibly damaging Het
Cables1 A G 18: 12,056,470 (GRCm39) E316G possibly damaging Het
Cadm1 A T 9: 47,761,629 (GRCm39) I427L probably damaging Het
Ccdc97 T C 7: 25,415,405 (GRCm39) D86G probably benign Het
Cgnl1 C A 9: 71,548,679 (GRCm39) D1081Y probably damaging Het
Cgnl1 T A 9: 71,632,122 (GRCm39) R410W probably damaging Het
Cntnap4 G A 8: 113,512,416 (GRCm39) E593K probably damaging Het
Dazap1 T C 10: 80,097,415 (GRCm39) probably benign Het
Dip2b A G 15: 100,113,121 (GRCm39) E1512G probably benign Het
Dock1 G A 7: 134,710,490 (GRCm39) V1171M possibly damaging Het
Dock5 A T 14: 68,018,485 (GRCm39) F1230Y probably benign Het
Dym G A 18: 75,176,243 (GRCm39) E15K possibly damaging Het
Ednra C A 8: 78,393,951 (GRCm39) probably null Het
Faf1 A G 4: 109,593,821 (GRCm39) Q133R probably benign Het
Fbxw28 A G 9: 109,157,279 (GRCm39) I323T probably benign Het
Fcer2a T C 8: 3,738,111 (GRCm39) probably benign Het
Fmo2 A T 1: 162,713,893 (GRCm39) S204R probably benign Het
Frmd4b A G 6: 97,400,460 (GRCm39) V63A probably damaging Het
Fzd8 G A 18: 9,213,985 (GRCm39) A356T possibly damaging Het
Ghitm A G 14: 36,853,549 (GRCm39) L97P probably damaging Het
Gins4 A G 8: 23,719,526 (GRCm39) probably benign Het
Golga3 T A 5: 110,350,643 (GRCm39) F766Y possibly damaging Het
Hapln1 T C 13: 89,755,997 (GRCm39) I267T probably benign Het
Helz A T 11: 107,563,384 (GRCm39) probably benign Het
Herc2 T C 7: 55,820,231 (GRCm39) V2851A possibly damaging Het
Igkv8-18 G A 6: 70,333,105 (GRCm39) probably benign Het
Igll1 A T 16: 16,681,740 (GRCm39) V5E probably benign Het
Irx3 T C 8: 92,527,168 (GRCm39) T179A possibly damaging Het
Kif16b A G 2: 142,699,225 (GRCm39) probably null Het
Limk1 A T 5: 134,688,725 (GRCm39) W507R probably damaging Het
Marf1 C T 16: 13,960,398 (GRCm39) A549T probably damaging Het
Mtif3 C A 5: 146,893,731 (GRCm39) V159F probably benign Het
Myh6 C T 14: 55,200,861 (GRCm39) R169Q probably damaging Het
Ncoa7 T A 10: 30,523,537 (GRCm39) D887V probably damaging Het
Obox7 C T 7: 14,398,313 (GRCm39) P76S probably benign Het
Or10ak12 A G 4: 118,666,677 (GRCm39) M128T probably benign Het
Or11l3 A T 11: 58,516,494 (GRCm39) I126N probably damaging Het
Pitpnm2 G A 5: 124,262,093 (GRCm39) A862V probably damaging Het
Pkd1 G C 17: 24,783,677 (GRCm39) A162P probably benign Het
Plce1 A G 19: 38,513,628 (GRCm39) D309G possibly damaging Het
Plk4 T C 3: 40,760,307 (GRCm39) V401A probably benign Het
Prdx3 T C 19: 60,862,950 (GRCm39) probably benign Het
Prrc2c C T 1: 162,526,453 (GRCm39) V253I unknown Het
Ranbp2 T A 10: 58,316,353 (GRCm39) S2358T probably damaging Het
Setd2 T A 9: 110,423,494 (GRCm39) V2183E probably damaging Het
Sgsm1 T A 5: 113,432,953 (GRCm39) S232C probably damaging Het
Skint6 A T 4: 112,904,012 (GRCm39) probably benign Het
Slc15a2 A G 16: 36,574,909 (GRCm39) I531T probably benign Het
Slc36a1 C T 11: 55,112,820 (GRCm39) probably benign Het
Sorbs2 C A 8: 46,249,300 (GRCm39) D831E probably damaging Het
Sorbs2 T A 8: 46,238,291 (GRCm39) probably null Het
Sptan1 T C 2: 29,883,708 (GRCm39) probably null Het
Stam T C 2: 14,142,952 (GRCm39) C336R probably damaging Het
Stil G T 4: 114,898,495 (GRCm39) A1042S probably damaging Het
Stxbp5l T A 16: 36,962,736 (GRCm39) D773V possibly damaging Het
Sugct A T 13: 17,847,166 (GRCm39) L39Q probably damaging Het
Tep1 A G 14: 51,071,522 (GRCm39) V2041A possibly damaging Het
Tex15 C T 8: 34,071,530 (GRCm39) probably benign Het
Tlr9 T G 9: 106,102,164 (GRCm39) L485R possibly damaging Het
Tmem207 A G 16: 26,343,579 (GRCm39) probably benign Het
Triml2 T C 8: 43,638,306 (GRCm39) probably benign Het
Trip6 A G 5: 137,309,107 (GRCm39) probably benign Het
Tspear T C 10: 77,705,465 (GRCm39) F288L probably benign Het
Vmn1r179 C T 7: 23,628,592 (GRCm39) T261I possibly damaging Het
Zfp644 A T 5: 106,784,869 (GRCm39) S559R possibly damaging Het
Other mutations in Ache
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02323:Ache APN 5 137,289,326 (GRCm39) missense probably damaging 1.00
IGL02833:Ache APN 5 137,289,371 (GRCm39) unclassified probably benign
R0358:Ache UTSW 5 137,288,635 (GRCm39) missense probably benign 0.21
R0377:Ache UTSW 5 137,289,190 (GRCm39) missense possibly damaging 0.54
R0780:Ache UTSW 5 137,288,794 (GRCm39) missense probably damaging 1.00
R1233:Ache UTSW 5 137,288,419 (GRCm39) splice site probably null
R1702:Ache UTSW 5 137,289,251 (GRCm39) missense possibly damaging 0.94
R1762:Ache UTSW 5 137,288,837 (GRCm39) missense possibly damaging 0.91
R4191:Ache UTSW 5 137,289,334 (GRCm39) missense probably damaging 0.98
R4226:Ache UTSW 5 137,289,152 (GRCm39) missense possibly damaging 0.83
R4499:Ache UTSW 5 137,290,194 (GRCm39) missense probably damaging 0.98
R4931:Ache UTSW 5 137,290,176 (GRCm39) missense probably benign 0.00
R5411:Ache UTSW 5 137,288,692 (GRCm39) splice site probably null
R5411:Ache UTSW 5 137,288,326 (GRCm39) missense possibly damaging 0.93
R5698:Ache UTSW 5 137,288,821 (GRCm39) missense probably damaging 1.00
R6153:Ache UTSW 5 137,290,117 (GRCm39) missense probably damaging 1.00
R6526:Ache UTSW 5 137,288,906 (GRCm39) missense probably damaging 1.00
R6896:Ache UTSW 5 137,289,996 (GRCm39) missense probably damaging 0.98
R6981:Ache UTSW 5 137,289,940 (GRCm39) missense probably benign
R7199:Ache UTSW 5 137,288,504 (GRCm39) missense probably damaging 1.00
R7208:Ache UTSW 5 137,289,751 (GRCm39) missense probably damaging 1.00
R8200:Ache UTSW 5 137,292,457 (GRCm39) missense probably damaging 1.00
R8338:Ache UTSW 5 137,290,006 (GRCm39) missense probably damaging 1.00
R8461:Ache UTSW 5 137,288,582 (GRCm39) missense probably damaging 0.96
R8933:Ache UTSW 5 137,288,449 (GRCm39) missense possibly damaging 0.56
R9146:Ache UTSW 5 137,289,077 (GRCm39) missense probably damaging 1.00
R9376:Ache UTSW 5 137,289,025 (GRCm39) missense probably benign
R9439:Ache UTSW 5 137,289,185 (GRCm39) missense probably damaging 0.97
X0061:Ache UTSW 5 137,288,357 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCAACGGCTTGCCTTGCAATG -3'
(R):5'- AGGACTGATTTTGGGACCCACAAAC -3'

Sequencing Primer
(F):5'- CTTGCCTTGCAATGGGTGC -3'
(R):5'- GGATCTGTAGTAAGCCCTCATGC -3'
Posted On 2013-05-09