Mutagenetix > Incidental Mutations

Incidental Mutation 'R4566:Vmn2r51'

343320

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r51

Ensembl Gene

ENSMUSG00000058685

Gene Name

vomeronasal 2, receptor 51

Synonyms

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.077) question?

Stock #

R4566 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

10087198-10105659 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 10102414 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Lysine at position 147 (E147K)

Ref Sequence

ENSEMBL: ENSMUSP00000092459 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094863]

Predicted Effect

probably benign
Transcript: ENSMUST00000094863
AA Change: E147K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000092459
Gene: ENSMUSG00000058685
AA Change: E147K

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	73	469	2.4e-31	PFAM
Pfam:NCD3G	512	565	8.1e-21	PFAM
Pfam:7tm_3	598	833	2.7e-54	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 21 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrv1	T	C	13: 81,419,808	E5082G	probably damaging	Het
Apol7a	A	T	15: 77,389,751	Y170*	probably null	Het
Cfhr1	T	A	1: 139,553,648	I165F	possibly damaging	Het
Dnah8	G	A	17: 30,748,568	D2585N	probably benign	Het
Espnl	C	A	1: 91,344,579	P510T	possibly damaging	Het
Fbxw4	A	G	19: 45,591,786	V258A	probably benign	Het
Foxq1	T	C	13: 31,559,488	M191T	probably benign	Het
Gabrg1	A	T	5: 70,842,141	L22I	probably benign	Het
Limk1	A	G	5: 134,686,683	L38P	probably benign	Het
Mfhas1	C	T	8: 35,591,049	R893C	probably damaging	Het
Mug2	G	A	6: 122,079,638	V1181I	probably benign	Het
Olfr655	A	T	7: 104,596,616	C188*	probably null	Het
Pithd1	A	G	4: 135,977,237	V56A	probably damaging	Het
Plxna4	T	C	6: 32,517,403	K93E	probably benign	Het
Ppp2cb	T	C	8: 33,610,695	V48A	possibly damaging	Het
Rasl2-9	AGG	A	7: 5,125,375		probably null	Het
Rrs1	T	C	1: 9,546,227	F235S	probably damaging	Het
Rtl1	G	A	12: 109,592,859	L849F	probably damaging	Het
Slc5a9	C	A	4: 111,891,744		probably null	Het
Trps1	A	G	15: 50,831,678	V116A	probably damaging	Het
Yy1	T	A	12: 108,812,963	I296K	probably damaging	Het

Other mutations in Vmn2r51

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01398:Vmn2r51	APN	7	10102414	missense	probably benign
IGL01574:Vmn2r51	APN	7	10102454	missense	probably damaging	1.00
IGL01743:Vmn2r51	APN	7	10100227	missense	probably damaging	0.98
IGL01820:Vmn2r51	APN	7	10105482	missense	probably damaging	1.00
IGL02563:Vmn2r51	APN	7	10100316	missense	probably benign	0.00
IGL02825:Vmn2r51	APN	7	10098119	splice site	probably benign
IGL02834:Vmn2r51	APN	7	10098136	nonsense	probably null
R0617:Vmn2r51	UTSW	7	10100469	missense	possibly damaging	0.65
R0967:Vmn2r51	UTSW	7	10100085	missense	probably damaging	0.97
R1465:Vmn2r51	UTSW	7	10100322	missense	probably damaging	1.00
R1465:Vmn2r51	UTSW	7	10100322	missense	probably damaging	1.00
R1559:Vmn2r51	UTSW	7	10102445	missense	possibly damaging	0.58
R1559:Vmn2r51	UTSW	7	10102446	missense	possibly damaging	0.87
R1598:Vmn2r51	UTSW	7	10105505	missense	probably benign
R1754:Vmn2r51	UTSW	7	10099946	missense	probably benign	0.04
R1836:Vmn2r51	UTSW	7	10098163	nonsense	probably null
R1836:Vmn2r51	UTSW	7	10098164	nonsense	probably null
R3151:Vmn2r51	UTSW	7	10100041	missense	probably damaging	1.00
R4933:Vmn2r51	UTSW	7	10098320	missense	probably damaging	1.00
R5004:Vmn2r51	UTSW	7	10088005	missense	probably benign
R5050:Vmn2r51	UTSW	7	10100422	missense	probably damaging	0.99
R5510:Vmn2r51	UTSW	7	10102618	missense	possibly damaging	0.95
R5559:Vmn2r51	UTSW	7	10092201	missense	probably damaging	1.00
R6127:Vmn2r51	UTSW	7	10105631	missense	probably damaging	1.00
R6154:Vmn2r51	UTSW	7	10087994	missense	possibly damaging	0.74
R6304:Vmn2r51	UTSW	7	10098237	missense	probably benign	0.00
R6370:Vmn2r51	UTSW	7	10098216	missense	probably damaging	1.00
R6471:Vmn2r51	UTSW	7	10102583	missense	possibly damaging	0.48
R6800:Vmn2r51	UTSW	7	10098264	missense	probably damaging	0.99
R6883:Vmn2r51	UTSW	7	10100098	missense	possibly damaging	0.75
R7191:Vmn2r51	UTSW	7	10100553	missense	probably null	1.00
R7246:Vmn2r51	UTSW	7	10102501	missense	probably benign	0.00
Z1176:Vmn2r51	UTSW	7	10088057	missense	possibly damaging	0.76
Z1176:Vmn2r51	UTSW	7	10099908	missense	probably benign	0.12

Predicted Primers

PCR Primer
(F):5'- TTCTGGTGGTAGCCCTTAGC -3'
(R):5'- ACTTCCAGTATAGCGTAGTGC -3'

Sequencing Primer
(F):5'- GCAAAAGGCCTAACATGTTTCTG -3'
(R):5'- CATTGGTGTTTGCAATGGATGAAATC -3'

Posted On

2015-09-24