Incidental Mutation 'R4566:Vmn2r51'
ID343320
Institutional Source Beutler Lab
Gene Symbol Vmn2r51
Ensembl Gene ENSMUSG00000058685
Gene Namevomeronasal 2, receptor 51
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R4566 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location10087198-10105659 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 10102414 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 147 (E147K)
Ref Sequence ENSEMBL: ENSMUSP00000092459 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094863]
Predicted Effect probably benign
Transcript: ENSMUST00000094863
AA Change: E147K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000092459
Gene: ENSMUSG00000058685
AA Change: E147K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 469 2.4e-31 PFAM
Pfam:NCD3G 512 565 8.1e-21 PFAM
Pfam:7tm_3 598 833 2.7e-54 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 T C 13: 81,419,808 E5082G probably damaging Het
Apol7a A T 15: 77,389,751 Y170* probably null Het
Cfhr1 T A 1: 139,553,648 I165F possibly damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Espnl C A 1: 91,344,579 P510T possibly damaging Het
Fbxw4 A G 19: 45,591,786 V258A probably benign Het
Foxq1 T C 13: 31,559,488 M191T probably benign Het
Gabrg1 A T 5: 70,842,141 L22I probably benign Het
Limk1 A G 5: 134,686,683 L38P probably benign Het
Mfhas1 C T 8: 35,591,049 R893C probably damaging Het
Mug2 G A 6: 122,079,638 V1181I probably benign Het
Olfr655 A T 7: 104,596,616 C188* probably null Het
Pithd1 A G 4: 135,977,237 V56A probably damaging Het
Plxna4 T C 6: 32,517,403 K93E probably benign Het
Ppp2cb T C 8: 33,610,695 V48A possibly damaging Het
Rasl2-9 AGG A 7: 5,125,375 probably null Het
Rrs1 T C 1: 9,546,227 F235S probably damaging Het
Rtl1 G A 12: 109,592,859 L849F probably damaging Het
Slc5a9 C A 4: 111,891,744 probably null Het
Trps1 A G 15: 50,831,678 V116A probably damaging Het
Yy1 T A 12: 108,812,963 I296K probably damaging Het
Other mutations in Vmn2r51
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01398:Vmn2r51 APN 7 10102414 missense probably benign
IGL01574:Vmn2r51 APN 7 10102454 missense probably damaging 1.00
IGL01743:Vmn2r51 APN 7 10100227 missense probably damaging 0.98
IGL01820:Vmn2r51 APN 7 10105482 missense probably damaging 1.00
IGL02563:Vmn2r51 APN 7 10100316 missense probably benign 0.00
IGL02825:Vmn2r51 APN 7 10098119 splice site probably benign
IGL02834:Vmn2r51 APN 7 10098136 nonsense probably null
R0617:Vmn2r51 UTSW 7 10100469 missense possibly damaging 0.65
R0967:Vmn2r51 UTSW 7 10100085 missense probably damaging 0.97
R1465:Vmn2r51 UTSW 7 10100322 missense probably damaging 1.00
R1465:Vmn2r51 UTSW 7 10100322 missense probably damaging 1.00
R1559:Vmn2r51 UTSW 7 10102445 missense possibly damaging 0.58
R1559:Vmn2r51 UTSW 7 10102446 missense possibly damaging 0.87
R1598:Vmn2r51 UTSW 7 10105505 missense probably benign
R1754:Vmn2r51 UTSW 7 10099946 missense probably benign 0.04
R1836:Vmn2r51 UTSW 7 10098163 nonsense probably null
R1836:Vmn2r51 UTSW 7 10098164 nonsense probably null
R3151:Vmn2r51 UTSW 7 10100041 missense probably damaging 1.00
R4933:Vmn2r51 UTSW 7 10098320 missense probably damaging 1.00
R5004:Vmn2r51 UTSW 7 10088005 missense probably benign
R5050:Vmn2r51 UTSW 7 10100422 missense probably damaging 0.99
R5510:Vmn2r51 UTSW 7 10102618 missense possibly damaging 0.95
R5559:Vmn2r51 UTSW 7 10092201 missense probably damaging 1.00
R6127:Vmn2r51 UTSW 7 10105631 missense probably damaging 1.00
R6154:Vmn2r51 UTSW 7 10087994 missense possibly damaging 0.74
R6304:Vmn2r51 UTSW 7 10098237 missense probably benign 0.00
R6370:Vmn2r51 UTSW 7 10098216 missense probably damaging 1.00
R6471:Vmn2r51 UTSW 7 10102583 missense possibly damaging 0.48
R6800:Vmn2r51 UTSW 7 10098264 missense probably damaging 0.99
R6883:Vmn2r51 UTSW 7 10100098 missense possibly damaging 0.75
R7191:Vmn2r51 UTSW 7 10100553 missense probably null 1.00
R7246:Vmn2r51 UTSW 7 10102501 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTCTGGTGGTAGCCCTTAGC -3'
(R):5'- ACTTCCAGTATAGCGTAGTGC -3'

Sequencing Primer
(F):5'- GCAAAAGGCCTAACATGTTTCTG -3'
(R):5'- CATTGGTGTTTGCAATGGATGAAATC -3'
Posted On2015-09-24