Incidental Mutation 'R4566:Ppp2cb'
ID343322
Institutional Source Beutler Lab
Gene Symbol Ppp2cb
Ensembl Gene ENSMUSG00000009630
Gene Nameprotein phosphatase 2 (formerly 2A), catalytic subunit, beta isoform
SynonymsPP2Ac, D8Ertd766e
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4566 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location33599625-33619441 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 33610695 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 48 (V48A)
Ref Sequence ENSEMBL: ENSMUSP00000009774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009774]
Predicted Effect possibly damaging
Transcript: ENSMUST00000009774
AA Change: V48A

PolyPhen 2 Score 0.667 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000009774
Gene: ENSMUSG00000009630
AA Change: V48A

DomainStartEndE-ValueType
PP2Ac 23 293 2.48e-156 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the phosphatase 2A catalytic subunit. Protein phosphatase 2A is one of the four major Ser/Thr phosphatases, and it is implicated in the negative control of cell growth and division. It consists of a common heteromeric core enzyme, which is composed of a catalytic subunit and a constant regulatory subunit, that associates with a variety of regulatory subunits. This gene encodes a beta isoform of the catalytic subunit. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 T C 13: 81,419,808 E5082G probably damaging Het
Apol7a A T 15: 77,389,751 Y170* probably null Het
Cfhr1 T A 1: 139,553,648 I165F possibly damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Espnl C A 1: 91,344,579 P510T possibly damaging Het
Fbxw4 A G 19: 45,591,786 V258A probably benign Het
Foxq1 T C 13: 31,559,488 M191T probably benign Het
Gabrg1 A T 5: 70,842,141 L22I probably benign Het
Limk1 A G 5: 134,686,683 L38P probably benign Het
Mfhas1 C T 8: 35,591,049 R893C probably damaging Het
Mug2 G A 6: 122,079,638 V1181I probably benign Het
Olfr655 A T 7: 104,596,616 C188* probably null Het
Pithd1 A G 4: 135,977,237 V56A probably damaging Het
Plxna4 T C 6: 32,517,403 K93E probably benign Het
Rasl2-9 AGG A 7: 5,125,375 probably null Het
Rrs1 T C 1: 9,546,227 F235S probably damaging Het
Rtl1 G A 12: 109,592,859 L849F probably damaging Het
Slc5a9 C A 4: 111,891,744 probably null Het
Trps1 A G 15: 50,831,678 V116A probably damaging Het
Vmn2r51 C T 7: 10,102,414 E147K probably benign Het
Yy1 T A 12: 108,812,963 I296K probably damaging Het
Other mutations in Ppp2cb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01566:Ppp2cb APN 8 33611763 missense probably benign 0.38
IGL02985:Ppp2cb APN 8 33615446 unclassified probably benign
IGL03251:Ppp2cb APN 8 33610651 splice site probably benign
Breakthrough UTSW 8 33615474 missense probably damaging 1.00
R0940:Ppp2cb UTSW 8 33615661 splice site probably null
R1688:Ppp2cb UTSW 8 33615452 missense probably benign 0.02
R2187:Ppp2cb UTSW 8 33610677 missense possibly damaging 0.95
R2350:Ppp2cb UTSW 8 33611827 missense probably null 1.00
R4418:Ppp2cb UTSW 8 33617049 missense probably benign
R6187:Ppp2cb UTSW 8 33615474 missense probably damaging 1.00
R6990:Ppp2cb UTSW 8 33619133 missense probably benign 0.01
R7477:Ppp2cb UTSW 8 33615474 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCCTATCTCTTCATAGGGTATTGG -3'
(R):5'- GCAACACTGACATTCTTTTGCC -3'

Sequencing Primer
(F):5'- ACTTCCAAGTGGTTTCCC -3'
(R):5'- GTATCCGTCAACCATACCTTTAATG -3'
Posted On2015-09-24