Incidental Mutation 'R4567:Olfr141'
ID343335
Institutional Source Beutler Lab
Gene Symbol Olfr141
Ensembl Gene ENSMUSG00000078420
Gene Nameolfactory receptor 141
SynonymsK17, MOR179-5, GA_x6K02T2Q125-48299679-48298702
MMRRC Submission 041791-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R4567 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location86804134-86810018 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86806802 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 66 (S66P)
Gene Model predicted gene model for transcript(s): [ENSMUST00000216117]
Predicted Effect probably damaging
Transcript: ENSMUST00000105212
AA Change: S66P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000100847
Gene: ENSMUSG00000078420
AA Change: S66P

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 3.3e-48 PFAM
Pfam:7tm_1 39 288 2.7e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201144
AA Change: S66P
Predicted Effect possibly damaging
Transcript: ENSMUST00000216117
AA Change: S66P

PolyPhen 2 Score 0.884 (Sensitivity: 0.82; Specificity: 0.94)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 95% (38/40)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T C 1: 26,683,117 D994G probably benign Het
Abhd16a T A 17: 35,096,523 L182Q probably damaging Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Alg12 T C 15: 88,806,353 probably benign Het
Asmt A G X: 170,676,526 probably null Het
Atp10b T C 11: 43,197,557 I330T probably benign Het
Dennd5a T C 7: 109,899,735 M998V probably benign Het
Erbb3 A G 10: 128,579,075 S401P probably damaging Het
Gm10718 A T 9: 3,023,716 T56S probably benign Het
Gm1527 A T 3: 28,914,407 N203Y probably damaging Het
Gm5155 T C 7: 17,908,966 S434P probably damaging Het
Gm6904 A T 14: 59,251,178 Y57N probably damaging Het
Hsf2bp C T 17: 31,946,734 V296M probably benign Het
Htr1d T A 4: 136,443,525 V355E probably benign Het
Ints11 T C 4: 155,885,675 V203A probably damaging Het
Iqsec3 A G 6: 121,387,762 V856A probably damaging Het
Olfr1371 T C 11: 52,213,464 H175R probably damaging Het
Olfr694 G A 7: 106,689,213 Q173* probably null Het
Pdzd3 C A 9: 44,249,026 V294L possibly damaging Het
Ppfia2 G A 10: 106,865,406 probably null Het
Prss23 T A 7: 89,510,866 probably benign Het
Rasl2-9 AGG A 7: 5,125,375 probably null Het
Rcn2 A T 9: 56,052,982 I178F probably benign Het
Rtn1 C T 12: 72,212,487 probably benign Het
Sik2 A G 9: 50,998,576 V59A probably damaging Het
Slc25a42 A T 8: 70,188,854 M159K probably damaging Het
Slc9a4 T C 1: 40,580,577 L21P probably damaging Het
Smap2 A C 4: 120,985,311 W41G probably damaging Het
Sox6 T C 7: 115,662,322 I220V probably benign Het
Syt17 A G 7: 118,434,272 V171A probably benign Het
Tjp1 A G 7: 65,306,501 F1332S probably damaging Het
Trim3 C T 7: 105,613,416 V512I possibly damaging Het
Uhmk1 G A 1: 170,205,117 Q282* probably null Het
Ushbp1 G A 8: 71,385,717 R648W probably damaging Het
Other mutations in Olfr141
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01608:Olfr141 APN 2 86806425 nonsense probably null
R0400:Olfr141 UTSW 2 86806651 missense probably damaging 1.00
R0609:Olfr141 UTSW 2 86806861 missense probably damaging 0.98
R1650:Olfr141 UTSW 2 86806747 missense possibly damaging 0.62
R1918:Olfr141 UTSW 2 86806827 missense probably damaging 1.00
R3975:Olfr141 UTSW 2 86806460 missense possibly damaging 0.95
R6090:Olfr141 UTSW 2 86806357 missense possibly damaging 0.85
R7286:Olfr141 UTSW 2 86806623 missense possibly damaging 0.62
R7910:Olfr141 UTSW 2 86806847 missense probably benign 0.00
R8048:Olfr141 UTSW 2 86806171 missense probably damaging 0.99
R8193:Olfr141 UTSW 2 86806865 missense noncoding transcript
R8799:Olfr141 UTSW 2 86806231 missense probably damaging 0.98
R8973:Olfr141 UTSW 2 86806856 missense probably benign
Predicted Primers PCR Primer
(F):5'- TACATATCGGTCATAAGCCATTGC -3'
(R):5'- CATAGCCCGCGTATCTTCAAC -3'

Sequencing Primer
(F):5'- CTGCCAAAAGAAAGCATTCTGTG -3'
(R):5'- TGAGGAACATCACAGAAGCTACTTTC -3'
Posted On2015-09-24