Incidental Mutation 'R4567:Gm1527'
ID343336
Institutional Source Beutler Lab
Gene Symbol Gm1527
Ensembl Gene ENSMUSG00000074655
Gene Namepredicted gene 1527
SynonymsLOC385263
MMRRC Submission 041791-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R4567 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location28892617-28926724 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 28914407 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 203 (N203Y)
Ref Sequence ENSEMBL: ENSMUSP00000096773 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099170]
Predicted Effect probably damaging
Transcript: ENSMUST00000099170
AA Change: N203Y

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000096773
Gene: ENSMUSG00000074655
AA Change: N203Y

DomainStartEndE-ValueType
PH 16 119 2.37e-6 SMART
Pfam:RA 125 214 1.7e-8 PFAM
RhoGAP 300 471 2.8e-29 SMART
transmembrane domain 623 645 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 95% (38/40)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T C 1: 26,683,117 D994G probably benign Het
Abhd16a T A 17: 35,096,523 L182Q probably damaging Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Alg12 T C 15: 88,806,353 probably benign Het
Asmt A G X: 170,676,526 probably null Het
Atp10b T C 11: 43,197,557 I330T probably benign Het
Dennd5a T C 7: 109,899,735 M998V probably benign Het
Erbb3 A G 10: 128,579,075 S401P probably damaging Het
Gm10718 A T 9: 3,023,716 T56S probably benign Het
Gm5155 T C 7: 17,908,966 S434P probably damaging Het
Gm6904 A T 14: 59,251,178 Y57N probably damaging Het
Hsf2bp C T 17: 31,946,734 V296M probably benign Het
Htr1d T A 4: 136,443,525 V355E probably benign Het
Ints11 T C 4: 155,885,675 V203A probably damaging Het
Iqsec3 A G 6: 121,387,762 V856A probably damaging Het
Olfr1371 T C 11: 52,213,464 H175R probably damaging Het
Olfr141 A G 2: 86,806,802 S66P probably damaging Het
Olfr694 G A 7: 106,689,213 Q173* probably null Het
Pdzd3 C A 9: 44,249,026 V294L possibly damaging Het
Ppfia2 G A 10: 106,865,406 probably null Het
Prss23 T A 7: 89,510,866 probably benign Het
Rasl2-9 AGG A 7: 5,125,375 probably null Het
Rcn2 A T 9: 56,052,982 I178F probably benign Het
Rtn1 C T 12: 72,212,487 probably benign Het
Sik2 A G 9: 50,998,576 V59A probably damaging Het
Slc25a42 A T 8: 70,188,854 M159K probably damaging Het
Slc9a4 T C 1: 40,580,577 L21P probably damaging Het
Smap2 A C 4: 120,985,311 W41G probably damaging Het
Sox6 T C 7: 115,662,322 I220V probably benign Het
Syt17 A G 7: 118,434,272 V171A probably benign Het
Tjp1 A G 7: 65,306,501 F1332S probably damaging Het
Trim3 C T 7: 105,613,416 V512I possibly damaging Het
Uhmk1 G A 1: 170,205,117 Q282* probably null Het
Ushbp1 G A 8: 71,385,717 R648W probably damaging Het
Other mutations in Gm1527
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01518:Gm1527 APN 3 28895588 utr 5 prime probably benign
IGL02069:Gm1527 APN 3 28926614 missense possibly damaging 0.53
IGL02794:Gm1527 APN 3 28895680 missense unknown
IGL03285:Gm1527 APN 3 28920417 missense probably damaging 1.00
PIT4403001:Gm1527 UTSW 3 28917985 missense possibly damaging 0.82
R0316:Gm1527 UTSW 3 28915774 missense probably damaging 1.00
R0487:Gm1527 UTSW 3 28926679 missense probably benign 0.00
R1411:Gm1527 UTSW 3 28914483 missense probably benign 0.04
R1458:Gm1527 UTSW 3 28918050 missense possibly damaging 0.52
R1470:Gm1527 UTSW 3 28915268 missense possibly damaging 0.82
R1470:Gm1527 UTSW 3 28915268 missense possibly damaging 0.82
R1476:Gm1527 UTSW 3 28926556 missense probably benign 0.19
R1523:Gm1527 UTSW 3 28920418 missense probably damaging 1.00
R1613:Gm1527 UTSW 3 28898853 critical splice donor site probably null
R1649:Gm1527 UTSW 3 28898731 missense probably damaging 1.00
R1722:Gm1527 UTSW 3 28921634 missense probably benign 0.10
R1760:Gm1527 UTSW 3 28895550 splice site probably benign
R1857:Gm1527 UTSW 3 28903390 missense probably damaging 0.99
R1981:Gm1527 UTSW 3 28915835 critical splice donor site probably null
R2063:Gm1527 UTSW 3 28926647 missense probably benign 0.04
R2080:Gm1527 UTSW 3 28926661 missense probably benign 0.01
R2115:Gm1527 UTSW 3 28917949 missense probably benign 0.00
R2440:Gm1527 UTSW 3 28895615 missense probably damaging 0.98
R3799:Gm1527 UTSW 3 28926596 missense possibly damaging 0.53
R4012:Gm1527 UTSW 3 28898820 missense probably benign 0.04
R4132:Gm1527 UTSW 3 28920630 missense probably benign 0.37
R4234:Gm1527 UTSW 3 28914366 missense probably damaging 1.00
R4406:Gm1527 UTSW 3 28895725 missense possibly damaging 0.81
R4528:Gm1527 UTSW 3 28914393 missense probably damaging 0.99
R4795:Gm1527 UTSW 3 28920663 missense possibly damaging 0.56
R4796:Gm1527 UTSW 3 28920663 missense possibly damaging 0.56
R5127:Gm1527 UTSW 3 28903418 missense probably damaging 1.00
R5774:Gm1527 UTSW 3 28918090 missense probably benign 0.22
R5890:Gm1527 UTSW 3 28915395 missense probably benign 0.03
R6024:Gm1527 UTSW 3 28920603 missense probably benign 0.10
R7092:Gm1527 UTSW 3 28914547 critical splice donor site probably null
R7128:Gm1527 UTSW 3 28915311 missense possibly damaging 0.95
R7197:Gm1527 UTSW 3 28926541 missense probably null 0.00
R7308:Gm1527 UTSW 3 28902280 missense probably benign 0.02
R7360:Gm1527 UTSW 3 28914542 nonsense probably null
R7380:Gm1527 UTSW 3 28920472 missense probably benign 0.10
R7566:Gm1527 UTSW 3 28920618 missense probably benign 0.02
R7864:Gm1527 UTSW 3 28926470 missense probably benign 0.01
R7896:Gm1527 UTSW 3 28921593 splice site probably null
R8261:Gm1527 UTSW 3 28920600 missense probably damaging 1.00
R8300:Gm1527 UTSW 3 28926595 missense possibly damaging 0.96
X0021:Gm1527 UTSW 3 28920468 missense probably damaging 1.00
X0028:Gm1527 UTSW 3 28914500 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AAGACTCCTAATGCTTTGGGG -3'
(R):5'- AGATCTCAAGCTGGACCTGG -3'

Sequencing Primer
(F):5'- GGGTAGAGTCTACATTGTTCAGAAG -3'
(R):5'- AAGCTGGACCTGGGGCATATTG -3'
Posted On2015-09-24