Incidental Mutation 'R4567:Ints11'
ID343341
Institutional Source Beutler Lab
Gene Symbol Ints11
Ensembl Gene ENSMUSG00000029034
Gene Nameintegrator complex subunit 11
Synonyms2410006F12Rik, Cpsf3l
MMRRC Submission 041791-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4567 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location155869546-155889103 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 155885675 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 203 (V203A)
Ref Sequence ENSEMBL: ENSMUSP00000112656 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030901] [ENSMUST00000097737] [ENSMUST00000120794] [ENSMUST00000156460]
Predicted Effect probably damaging
Transcript: ENSMUST00000030901
AA Change: V225A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030901
Gene: ENSMUSG00000029034
AA Change: V225A

DomainStartEndE-ValueType
Lactamase_B 16 233 3.38e-17 SMART
Beta-Casp 245 363 6.94e-37 SMART
Pfam:RMMBL 376 418 1.1e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000097737
SMART Domains Protein: ENSMUSP00000095344
Gene: ENSMUSG00000051557

DomainStartEndE-ValueType
Pfam:PseudoU_synth_1 16 124 2.5e-12 PFAM
Pfam:PseudoU_synth_1 168 285 1.1e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120794
AA Change: V203A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112656
Gene: ENSMUSG00000029034
AA Change: V203A

DomainStartEndE-ValueType
Lactamase_B 16 211 6.42e-9 SMART
Beta-Casp 223 341 6.94e-37 SMART
Pfam:RMMBL 354 396 3.6e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123504
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129637
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132632
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134678
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135844
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142724
Predicted Effect probably benign
Transcript: ENSMUST00000156460
SMART Domains Protein: ENSMUSP00000118803
Gene: ENSMUSG00000029034

DomainStartEndE-ValueType
SCOP:d1smla_ 1 66 7e-7 SMART
PDB:2I7V|A 3 38 1e-9 PDB
Blast:Lactamase_B 16 66 4e-30 BLAST
Meta Mutation Damage Score 0.6306 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 95% (38/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Integrator complex contains at least 12 subunits and associates with the C-terminal domain of RNA polymerase II large subunit (POLR2A; MIM 180660) and mediates the 3-prime end processing of small nuclear RNAs U1 (RNU1; MIM 180680) and U2 (RNU2; MIM 180690). INTS11, or CPSF3L, is the catalytic subunit of the Integrator complex (Baillat et al., 2005 [PubMed 16239144]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T C 1: 26,683,117 D994G probably benign Het
Abhd16a T A 17: 35,096,523 L182Q probably damaging Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Alg12 T C 15: 88,806,353 probably benign Het
Asmt A G X: 170,676,526 probably null Het
Atp10b T C 11: 43,197,557 I330T probably benign Het
Dennd5a T C 7: 109,899,735 M998V probably benign Het
Erbb3 A G 10: 128,579,075 S401P probably damaging Het
Gm10718 A T 9: 3,023,716 T56S probably benign Het
Gm1527 A T 3: 28,914,407 N203Y probably damaging Het
Gm5155 T C 7: 17,908,966 S434P probably damaging Het
Gm6904 A T 14: 59,251,178 Y57N probably damaging Het
Hsf2bp C T 17: 31,946,734 V296M probably benign Het
Htr1d T A 4: 136,443,525 V355E probably benign Het
Iqsec3 A G 6: 121,387,762 V856A probably damaging Het
Olfr1371 T C 11: 52,213,464 H175R probably damaging Het
Olfr141 A G 2: 86,806,802 S66P probably damaging Het
Olfr694 G A 7: 106,689,213 Q173* probably null Het
Pdzd3 C A 9: 44,249,026 V294L possibly damaging Het
Ppfia2 G A 10: 106,865,406 probably null Het
Prss23 T A 7: 89,510,866 probably benign Het
Rasl2-9 AGG A 7: 5,125,375 probably null Het
Rcn2 A T 9: 56,052,982 I178F probably benign Het
Rtn1 C T 12: 72,212,487 probably benign Het
Sik2 A G 9: 50,998,576 V59A probably damaging Het
Slc25a42 A T 8: 70,188,854 M159K probably damaging Het
Slc9a4 T C 1: 40,580,577 L21P probably damaging Het
Smap2 A C 4: 120,985,311 W41G probably damaging Het
Sox6 T C 7: 115,662,322 I220V probably benign Het
Syt17 A G 7: 118,434,272 V171A probably benign Het
Tjp1 A G 7: 65,306,501 F1332S probably damaging Het
Trim3 C T 7: 105,613,416 V512I possibly damaging Het
Uhmk1 G A 1: 170,205,117 Q282* probably null Het
Ushbp1 G A 8: 71,385,717 R648W probably damaging Het
Other mutations in Ints11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01145:Ints11 APN 4 155885126 missense probably damaging 1.00
IGL01515:Ints11 APN 4 155875232 missense probably damaging 1.00
IGL01613:Ints11 APN 4 155885198 critical splice donor site probably null
IGL02024:Ints11 APN 4 155888515 missense probably damaging 1.00
IGL02127:Ints11 APN 4 155886863 missense probably damaging 1.00
IGL02850:Ints11 APN 4 155875304 missense probably benign 0.03
IGL02926:Ints11 APN 4 155888111 critical splice donor site probably null
IGL03296:Ints11 APN 4 155885323 critical splice donor site probably null
IGL03357:Ints11 APN 4 155872124 splice site probably benign
R0013:Ints11 UTSW 4 155887168 missense probably damaging 1.00
R0013:Ints11 UTSW 4 155887168 missense probably damaging 1.00
R0449:Ints11 UTSW 4 155887948 missense probably benign 0.17
R0480:Ints11 UTSW 4 155887624 missense probably damaging 1.00
R0589:Ints11 UTSW 4 155886886 missense probably damaging 1.00
R0678:Ints11 UTSW 4 155887753 missense probably damaging 1.00
R0865:Ints11 UTSW 4 155887107 splice site probably null
R1135:Ints11 UTSW 4 155887927 splice site probably null
R1466:Ints11 UTSW 4 155888110 critical splice donor site probably null
R1466:Ints11 UTSW 4 155888110 critical splice donor site probably null
R1658:Ints11 UTSW 4 155887728 missense probably damaging 0.97
R1707:Ints11 UTSW 4 155875198 missense probably benign 0.21
R2199:Ints11 UTSW 4 155875281 missense probably benign 0.07
R2876:Ints11 UTSW 4 155887425 unclassified probably benign
R4900:Ints11 UTSW 4 155888430 missense probably benign 0.01
R4964:Ints11 UTSW 4 155886928 missense probably damaging 1.00
R4966:Ints11 UTSW 4 155886928 missense probably damaging 1.00
R5306:Ints11 UTSW 4 155875208 missense probably damaging 1.00
R5963:Ints11 UTSW 4 155872912 nonsense probably null
R6246:Ints11 UTSW 4 155888089 missense probably benign
R7285:Ints11 UTSW 4 155886111 missense probably damaging 1.00
R7365:Ints11 UTSW 4 155872230 splice site probably null
R7768:Ints11 UTSW 4 155886939 missense probably damaging 0.97
R7774:Ints11 UTSW 4 155885683 missense probably benign 0.00
R7999:Ints11 UTSW 4 155886956 missense probably benign 0.12
R8103:Ints11 UTSW 4 155888230 missense possibly damaging 0.93
R8785:Ints11 UTSW 4 155869708 missense probably benign 0.17
R8825:Ints11 UTSW 4 155885130 nonsense probably null
Z1088:Ints11 UTSW 4 155886970 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- AGGTAGAGGAGCTTATGCCG -3'
(R):5'- TCATGATCAGCTCTTCATCGG -3'

Sequencing Primer
(F):5'- CCGGGGGCTAATTCTGTAGTC -3'
(R):5'- GATCAGCTCTTCATCGGATGTAAG -3'
Posted On2015-09-24