Incidental Mutation 'R4567:Rasl2-9'
ID343344
Institutional Source Beutler Lab
Gene Symbol Rasl2-9
Ensembl Gene ENSMUSG00000083649
Gene NameRAS-like, family 2, locus 9
SynonymsRasl2-9-ps, Ran/M2
MMRRC Submission 041791-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.917) question?
Stock #R4567 (G1)
Quality Score217
Status Validated
Chromosome7
Chromosomal Location5124938-5125950 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) AGG to A at 5125375 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000129559 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000147835]
Predicted Effect probably null
Transcript: ENSMUST00000147835
SMART Domains Protein: ENSMUSP00000129559
Gene: ENSMUSG00000083649

DomainStartEndE-ValueType
RAN 16 216 1.25e-161 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175212
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207732
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 95% (38/40)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T C 1: 26,683,117 D994G probably benign Het
Abhd16a T A 17: 35,096,523 L182Q probably damaging Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Alg12 T C 15: 88,806,353 probably benign Het
Asmt A G X: 170,676,526 probably null Het
Atp10b T C 11: 43,197,557 I330T probably benign Het
Dennd5a T C 7: 109,899,735 M998V probably benign Het
Erbb3 A G 10: 128,579,075 S401P probably damaging Het
Gm10718 A T 9: 3,023,716 T56S probably benign Het
Gm1527 A T 3: 28,914,407 N203Y probably damaging Het
Gm5155 T C 7: 17,908,966 S434P probably damaging Het
Gm6904 A T 14: 59,251,178 Y57N probably damaging Het
Hsf2bp C T 17: 31,946,734 V296M probably benign Het
Htr1d T A 4: 136,443,525 V355E probably benign Het
Ints11 T C 4: 155,885,675 V203A probably damaging Het
Iqsec3 A G 6: 121,387,762 V856A probably damaging Het
Olfr1371 T C 11: 52,213,464 H175R probably damaging Het
Olfr141 A G 2: 86,806,802 S66P probably damaging Het
Olfr694 G A 7: 106,689,213 Q173* probably null Het
Pdzd3 C A 9: 44,249,026 V294L possibly damaging Het
Ppfia2 G A 10: 106,865,406 probably null Het
Prss23 T A 7: 89,510,866 probably benign Het
Rcn2 A T 9: 56,052,982 I178F probably benign Het
Rtn1 C T 12: 72,212,487 probably benign Het
Sik2 A G 9: 50,998,576 V59A probably damaging Het
Slc25a42 A T 8: 70,188,854 M159K probably damaging Het
Slc9a4 T C 1: 40,580,577 L21P probably damaging Het
Smap2 A C 4: 120,985,311 W41G probably damaging Het
Sox6 T C 7: 115,662,322 I220V probably benign Het
Syt17 A G 7: 118,434,272 V171A probably benign Het
Tjp1 A G 7: 65,306,501 F1332S probably damaging Het
Trim3 C T 7: 105,613,416 V512I possibly damaging Het
Uhmk1 G A 1: 170,205,117 Q282* probably null Het
Ushbp1 G A 8: 71,385,717 R648W probably damaging Het
Other mutations in Rasl2-9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02110:Rasl2-9 APN 7 5125347 missense probably benign 0.00
R1500:Rasl2-9 UTSW 7 5125442 nonsense probably null
R4566:Rasl2-9 UTSW 7 5125375 frame shift probably null
R4568:Rasl2-9 UTSW 7 5125375 frame shift probably null
R4745:Rasl2-9 UTSW 7 5125703 missense possibly damaging 0.90
R7301:Rasl2-9 UTSW 7 5125740 missense probably damaging 1.00
R8025:Rasl2-9 UTSW 7 5125482 missense probably damaging 1.00
R8281:Rasl2-9 UTSW 7 5125352 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTCCTTTAGCTAAATAAGGTGGCAC -3'
(R):5'- TCCCCATTGTATTGTGTGGC -3'

Sequencing Primer
(F):5'- CACACACTGCACCGCTGG -3'
(R):5'- GGCAACAAAGTGGATGTTAAAGAC -3'
Posted On2015-09-24