Incidental Mutation 'R4567:Prss23'
ID343347
Institutional Source Beutler Lab
Gene Symbol Prss23
Ensembl Gene ENSMUSG00000039405
Gene Nameprotease, serine 23
Synonyms2310046G15Rik
MMRRC Submission 041791-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R4567 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location89507783-89527187 bp(-) (GRCm38)
Type of Mutationutr 5 prime
DNA Base Change (assembly) T to A at 89510866 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146825 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041761] [ENSMUST00000207538] [ENSMUST00000207636] [ENSMUST00000207932] [ENSMUST00000208402] [ENSMUST00000208888] [ENSMUST00000208903]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000032858
Predicted Effect probably benign
Transcript: ENSMUST00000041761
SMART Domains Protein: ENSMUSP00000045191
Gene: ENSMUSG00000039405

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 48 57 N/A INTRINSIC
Tryp_SPc 137 372 2.87e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179361
Predicted Effect probably benign
Transcript: ENSMUST00000207538
Predicted Effect probably benign
Transcript: ENSMUST00000207636
Predicted Effect probably benign
Transcript: ENSMUST00000207932
Predicted Effect probably benign
Transcript: ENSMUST00000208402
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208814
Predicted Effect probably benign
Transcript: ENSMUST00000208888
Predicted Effect probably benign
Transcript: ENSMUST00000208903
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209064
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209118
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 95% (38/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a conserved member of the trypsin family of serine proteases. Mouse studies found a decrease of mRNA levels of this gene after ovulation was induced. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T C 1: 26,683,117 D994G probably benign Het
Abhd16a T A 17: 35,096,523 L182Q probably damaging Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Alg12 T C 15: 88,806,353 probably benign Het
Asmt A G X: 170,676,526 probably null Het
Atp10b T C 11: 43,197,557 I330T probably benign Het
Dennd5a T C 7: 109,899,735 M998V probably benign Het
Erbb3 A G 10: 128,579,075 S401P probably damaging Het
Gm10718 A T 9: 3,023,716 T56S probably benign Het
Gm1527 A T 3: 28,914,407 N203Y probably damaging Het
Gm5155 T C 7: 17,908,966 S434P probably damaging Het
Gm6904 A T 14: 59,251,178 Y57N probably damaging Het
Hsf2bp C T 17: 31,946,734 V296M probably benign Het
Htr1d T A 4: 136,443,525 V355E probably benign Het
Ints11 T C 4: 155,885,675 V203A probably damaging Het
Iqsec3 A G 6: 121,387,762 V856A probably damaging Het
Olfr1371 T C 11: 52,213,464 H175R probably damaging Het
Olfr141 A G 2: 86,806,802 S66P probably damaging Het
Olfr694 G A 7: 106,689,213 Q173* probably null Het
Pdzd3 C A 9: 44,249,026 V294L possibly damaging Het
Ppfia2 G A 10: 106,865,406 probably null Het
Rasl2-9 AGG A 7: 5,125,375 probably null Het
Rcn2 A T 9: 56,052,982 I178F probably benign Het
Rtn1 C T 12: 72,212,487 probably benign Het
Sik2 A G 9: 50,998,576 V59A probably damaging Het
Slc25a42 A T 8: 70,188,854 M159K probably damaging Het
Slc9a4 T C 1: 40,580,577 L21P probably damaging Het
Smap2 A C 4: 120,985,311 W41G probably damaging Het
Sox6 T C 7: 115,662,322 I220V probably benign Het
Syt17 A G 7: 118,434,272 V171A probably benign Het
Tjp1 A G 7: 65,306,501 F1332S probably damaging Het
Trim3 C T 7: 105,613,416 V512I possibly damaging Het
Uhmk1 G A 1: 170,205,117 Q282* probably null Het
Ushbp1 G A 8: 71,385,717 R648W probably damaging Het
Other mutations in Prss23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01296:Prss23 APN 7 89509887 missense possibly damaging 0.83
IGL03308:Prss23 APN 7 89509730 missense probably benign 0.09
IGL03349:Prss23 APN 7 89509857 missense probably benign 0.09
IGL03378:Prss23 APN 7 89510144 missense probably damaging 0.99
R0394:Prss23 UTSW 7 89509847 missense probably damaging 1.00
R1026:Prss23 UTSW 7 89509958 missense probably benign 0.01
R1417:Prss23 UTSW 7 89510184 missense probably damaging 1.00
R1467:Prss23 UTSW 7 89510009 missense probably damaging 1.00
R1467:Prss23 UTSW 7 89510009 missense probably damaging 1.00
R1691:Prss23 UTSW 7 89510714 missense probably benign 0.18
R1806:Prss23 UTSW 7 89510391 missense probably damaging 1.00
R2153:Prss23 UTSW 7 89509911 missense probably damaging 1.00
R3420:Prss23 UTSW 7 89509899 missense possibly damaging 0.91
R3849:Prss23 UTSW 7 89509751 missense probably damaging 1.00
R4828:Prss23 UTSW 7 89509900 nonsense probably null
R5010:Prss23 UTSW 7 89510214 missense probably benign 0.25
R5251:Prss23 UTSW 7 89510322 missense probably damaging 1.00
R5399:Prss23 UTSW 7 89509966 missense probably benign 0.02
R5629:Prss23 UTSW 7 89510192 missense probably damaging 1.00
R5697:Prss23 UTSW 7 89509982 missense probably damaging 0.99
R6378:Prss23 UTSW 7 89510033 missense probably damaging 1.00
R6716:Prss23 UTSW 7 89509847 missense probably damaging 1.00
R6880:Prss23 UTSW 7 89510825 missense probably benign 0.03
R7097:Prss23 UTSW 7 89510184 missense probably damaging 1.00
R7362:Prss23 UTSW 7 89509764 missense probably damaging 1.00
R7563:Prss23 UTSW 7 89509830 missense probably damaging 1.00
R7637:Prss23 UTSW 7 89510246 missense probably benign 0.00
R7815:Prss23 UTSW 7 89510045 missense probably damaging 0.99
R8047:Prss23 UTSW 7 89509928 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGGTGTTCCCTTGTGACAC -3'
(R):5'- AAGTCCTTGCATGTAAGTGAGAC -3'

Sequencing Primer
(F):5'- CTTGTGACACTGAGGTCCACATG -3'
(R):5'- CCTTGCATGTAAGTGAGACCATTACC -3'
Posted On2015-09-24