Incidental Mutation 'R4567:Syt17'
ID343351
Institutional Source Beutler Lab
Gene Symbol Syt17
Ensembl Gene ENSMUSG00000058420
Gene Namesynaptotagmin XVII
SynonymsBk
MMRRC Submission 041791-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4567 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location118380717-118448222 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 118434272 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 171 (V171A)
Ref Sequence ENSEMBL: ENSMUSP00000144987 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081574] [ENSMUST00000203465] [ENSMUST00000203485] [ENSMUST00000203796] [ENSMUST00000207034]
Predicted Effect probably benign
Transcript: ENSMUST00000081574
AA Change: V167A

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000080284
Gene: ENSMUSG00000058420
AA Change: V167A

DomainStartEndE-ValueType
low complexity region 90 102 N/A INTRINSIC
low complexity region 103 118 N/A INTRINSIC
low complexity region 159 172 N/A INTRINSIC
C2 196 305 7.92e-19 SMART
low complexity region 315 328 N/A INTRINSIC
C2 333 448 2.8e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203465
AA Change: V166A

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect probably benign
Transcript: ENSMUST00000203485
AA Change: V171A

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000144987
Gene: ENSMUSG00000058420
AA Change: V171A

DomainStartEndE-ValueType
low complexity region 94 106 N/A INTRINSIC
low complexity region 107 122 N/A INTRINSIC
low complexity region 163 176 N/A INTRINSIC
C2 200 309 5.2e-21 SMART
low complexity region 319 332 N/A INTRINSIC
C2 337 419 3.1e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203796
AA Change: V110A

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000145087
Gene: ENSMUSG00000058420
AA Change: V110A

DomainStartEndE-ValueType
low complexity region 33 45 N/A INTRINSIC
low complexity region 46 61 N/A INTRINSIC
low complexity region 102 115 N/A INTRINSIC
C2 139 248 5.2e-21 SMART
low complexity region 258 271 N/A INTRINSIC
C2 276 391 1.9e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207034
Meta Mutation Damage Score 0.0797 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 95% (38/40)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T C 1: 26,683,117 D994G probably benign Het
Abhd16a T A 17: 35,096,523 L182Q probably damaging Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Alg12 T C 15: 88,806,353 probably benign Het
Asmt A G X: 170,676,526 probably null Het
Atp10b T C 11: 43,197,557 I330T probably benign Het
Dennd5a T C 7: 109,899,735 M998V probably benign Het
Erbb3 A G 10: 128,579,075 S401P probably damaging Het
Gm10718 A T 9: 3,023,716 T56S probably benign Het
Gm1527 A T 3: 28,914,407 N203Y probably damaging Het
Gm5155 T C 7: 17,908,966 S434P probably damaging Het
Gm6904 A T 14: 59,251,178 Y57N probably damaging Het
Hsf2bp C T 17: 31,946,734 V296M probably benign Het
Htr1d T A 4: 136,443,525 V355E probably benign Het
Ints11 T C 4: 155,885,675 V203A probably damaging Het
Iqsec3 A G 6: 121,387,762 V856A probably damaging Het
Olfr1371 T C 11: 52,213,464 H175R probably damaging Het
Olfr141 A G 2: 86,806,802 S66P probably damaging Het
Olfr694 G A 7: 106,689,213 Q173* probably null Het
Pdzd3 C A 9: 44,249,026 V294L possibly damaging Het
Ppfia2 G A 10: 106,865,406 probably null Het
Prss23 T A 7: 89,510,866 probably benign Het
Rasl2-9 AGG A 7: 5,125,375 probably null Het
Rcn2 A T 9: 56,052,982 I178F probably benign Het
Rtn1 C T 12: 72,212,487 probably benign Het
Sik2 A G 9: 50,998,576 V59A probably damaging Het
Slc25a42 A T 8: 70,188,854 M159K probably damaging Het
Slc9a4 T C 1: 40,580,577 L21P probably damaging Het
Smap2 A C 4: 120,985,311 W41G probably damaging Het
Sox6 T C 7: 115,662,322 I220V probably benign Het
Tjp1 A G 7: 65,306,501 F1332S probably damaging Het
Trim3 C T 7: 105,613,416 V512I possibly damaging Het
Uhmk1 G A 1: 170,205,117 Q282* probably null Het
Ushbp1 G A 8: 71,385,717 R648W probably damaging Het
Other mutations in Syt17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Syt17 APN 7 118434290 missense probably damaging 0.98
IGL01135:Syt17 APN 7 118382047 missense possibly damaging 0.92
IGL01331:Syt17 APN 7 118408166 missense probably damaging 0.99
IGL01610:Syt17 APN 7 118433993 missense possibly damaging 0.90
IGL01776:Syt17 APN 7 118409953 missense probably damaging 0.99
IGL02125:Syt17 APN 7 118409974 missense probably benign 0.01
IGL02819:Syt17 APN 7 118409920 splice site probably benign
H8562:Syt17 UTSW 7 118408069 missense probably benign 0.01
R0127:Syt17 UTSW 7 118409941 missense probably damaging 0.98
R0328:Syt17 UTSW 7 118381993 missense probably benign 0.28
R1789:Syt17 UTSW 7 118436838 missense probably benign 0.00
R1872:Syt17 UTSW 7 118408118 missense probably benign 0.00
R1878:Syt17 UTSW 7 118434245 missense probably benign 0.01
R1918:Syt17 UTSW 7 118433985 missense possibly damaging 0.54
R2133:Syt17 UTSW 7 118382047 missense possibly damaging 0.92
R3777:Syt17 UTSW 7 118433957 missense probably damaging 1.00
R4471:Syt17 UTSW 7 118436817 splice site probably null
R4472:Syt17 UTSW 7 118436817 splice site probably null
R5211:Syt17 UTSW 7 118442403 missense probably benign 0.19
R5905:Syt17 UTSW 7 118436918 missense probably benign 0.10
R6054:Syt17 UTSW 7 118408133 missense possibly damaging 0.91
R6276:Syt17 UTSW 7 118434290 missense probably damaging 0.98
R6332:Syt17 UTSW 7 118434243 missense probably benign 0.00
R7022:Syt17 UTSW 7 118408019 missense probably benign 0.00
R7440:Syt17 UTSW 7 118381884 missense probably damaging 1.00
R7610:Syt17 UTSW 7 118434459 splice site probably null
R7845:Syt17 UTSW 7 118409971 missense possibly damaging 0.79
R7928:Syt17 UTSW 7 118409971 missense possibly damaging 0.79
Z1177:Syt17 UTSW 7 118434223 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- AGGCAGATCTTGACGTAGGG -3'
(R):5'- AGCAGGTGACCATTGTTCTTGG -3'

Sequencing Primer
(F):5'- CAGATCTTGACGTAGGGGTTGGAG -3'
(R):5'- TAGGTCTGGATTCCCGGC -3'
Posted On2015-09-24