Incidental Mutation 'R4567:Pdzd3'
ID343355
Institutional Source Beutler Lab
Gene Symbol Pdzd3
Ensembl Gene ENSMUSG00000032105
Gene NamePDZ domain containing 3
Synonymssodium-phosphate cotransporter IIa C-terminal-associated protein 2, Pdzk2, NaPi-Cap2
MMRRC Submission 041791-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4567 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location44247307-44251471 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 44249026 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 294 (V294L)
Ref Sequence ENSEMBL: ENSMUSP00000034618 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034618] [ENSMUST00000034621] [ENSMUST00000092426] [ENSMUST00000168499] [ENSMUST00000169651] [ENSMUST00000213891] [ENSMUST00000215554] [ENSMUST00000215711] [ENSMUST00000216632] [ENSMUST00000217221] [ENSMUST00000217510]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034618
AA Change: V294L

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000034618
Gene: ENSMUSG00000032105
AA Change: V294L

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
PDZ 58 130 2.04e-15 SMART
PDZ 165 235 2.93e-7 SMART
PDZ 271 346 2.47e-14 SMART
PDZ 403 475 1.4e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000034621
SMART Domains Protein: ENSMUSP00000034621
Gene: ENSMUSG00000032109

DomainStartEndE-ValueType
Pfam:NACHT 160 325 1.1e-22 PFAM
low complexity region 543 556 N/A INTRINSIC
LRR 695 722 1.66e2 SMART
LRR 749 776 3.59e1 SMART
LRR 778 805 6.23e-2 SMART
LRR 806 833 1.13e0 SMART
LRR 834 861 1.99e1 SMART
LRR 862 885 8.11e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000092426
SMART Domains Protein: ENSMUSP00000090082
Gene: ENSMUSG00000070306

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
coiled coil region 26 148 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168499
SMART Domains Protein: ENSMUSP00000127531
Gene: ENSMUSG00000032109

DomainStartEndE-ValueType
Pfam:NACHT 160 325 1.3e-23 PFAM
low complexity region 543 556 N/A INTRINSIC
LRR 695 722 1.66e2 SMART
LRR 749 776 3.59e1 SMART
LRR 778 805 6.23e-2 SMART
LRR 806 833 1.13e0 SMART
LRR 834 861 1.99e1 SMART
LRR 862 885 8.11e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169651
SMART Domains Protein: ENSMUSP00000126555
Gene: ENSMUSG00000032109

DomainStartEndE-ValueType
Pfam:NACHT 160 325 1.3e-23 PFAM
low complexity region 543 556 N/A INTRINSIC
LRR 695 722 1.66e2 SMART
LRR 749 776 3.59e1 SMART
LRR 778 805 6.23e-2 SMART
LRR 806 833 1.13e0 SMART
LRR 834 861 1.99e1 SMART
LRR 862 885 8.11e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213186
Predicted Effect probably benign
Transcript: ENSMUST00000213891
Predicted Effect probably benign
Transcript: ENSMUST00000215554
Predicted Effect probably benign
Transcript: ENSMUST00000215711
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216047
Predicted Effect probably benign
Transcript: ENSMUST00000216632
Predicted Effect probably benign
Transcript: ENSMUST00000217221
Predicted Effect probably benign
Transcript: ENSMUST00000217510
Meta Mutation Damage Score 0.1692 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 95% (38/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Guanylyl cyclase C (GCC, or GUCY2C; MIM 601330) produces cGMP following the binding of either endogenous ligands or heat-stable enterotoxins secreted by E. coli and other enteric bacteria. Activation of GCC initiates a signaling cascade that leads to phosphorylation of the cystic fibrosis transmembrane conductance regulator (CFTR; MIM 602421), followed by a net efflux of ions and water into the intestinal lumen. IKEPP is a regulatory protein that associates with GCC and regulates the amount of cGMP produced following receptor stimulation (Scott et al., 2002 [PubMed 11950846]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T C 1: 26,683,117 D994G probably benign Het
Abhd16a T A 17: 35,096,523 L182Q probably damaging Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Alg12 T C 15: 88,806,353 probably benign Het
Asmt A G X: 170,676,526 probably null Het
Atp10b T C 11: 43,197,557 I330T probably benign Het
Dennd5a T C 7: 109,899,735 M998V probably benign Het
Erbb3 A G 10: 128,579,075 S401P probably damaging Het
Gm10718 A T 9: 3,023,716 T56S probably benign Het
Gm1527 A T 3: 28,914,407 N203Y probably damaging Het
Gm5155 T C 7: 17,908,966 S434P probably damaging Het
Gm6904 A T 14: 59,251,178 Y57N probably damaging Het
Hsf2bp C T 17: 31,946,734 V296M probably benign Het
Htr1d T A 4: 136,443,525 V355E probably benign Het
Ints11 T C 4: 155,885,675 V203A probably damaging Het
Iqsec3 A G 6: 121,387,762 V856A probably damaging Het
Olfr1371 T C 11: 52,213,464 H175R probably damaging Het
Olfr141 A G 2: 86,806,802 S66P probably damaging Het
Olfr694 G A 7: 106,689,213 Q173* probably null Het
Ppfia2 G A 10: 106,865,406 probably null Het
Prss23 T A 7: 89,510,866 probably benign Het
Rasl2-9 AGG A 7: 5,125,375 probably null Het
Rcn2 A T 9: 56,052,982 I178F probably benign Het
Rtn1 C T 12: 72,212,487 probably benign Het
Sik2 A G 9: 50,998,576 V59A probably damaging Het
Slc25a42 A T 8: 70,188,854 M159K probably damaging Het
Slc9a4 T C 1: 40,580,577 L21P probably damaging Het
Smap2 A C 4: 120,985,311 W41G probably damaging Het
Sox6 T C 7: 115,662,322 I220V probably benign Het
Syt17 A G 7: 118,434,272 V171A probably benign Het
Tjp1 A G 7: 65,306,501 F1332S probably damaging Het
Trim3 C T 7: 105,613,416 V512I possibly damaging Het
Uhmk1 G A 1: 170,205,117 Q282* probably null Het
Ushbp1 G A 8: 71,385,717 R648W probably damaging Het
Other mutations in Pdzd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00861:Pdzd3 APN 9 44249636 missense possibly damaging 0.84
IGL01639:Pdzd3 APN 9 44248679 missense probably benign 0.41
IGL02210:Pdzd3 APN 9 44248317 missense probably benign
IGL02502:Pdzd3 APN 9 44249651 missense probably benign
IGL03082:Pdzd3 APN 9 44250786 missense possibly damaging 0.65
R0543:Pdzd3 UTSW 9 44248934 missense probably damaging 1.00
R1180:Pdzd3 UTSW 9 44249246 missense probably benign 0.38
R1919:Pdzd3 UTSW 9 44250303 missense possibly damaging 0.83
R4019:Pdzd3 UTSW 9 44250820 splice site probably null
R4020:Pdzd3 UTSW 9 44250820 splice site probably null
R4296:Pdzd3 UTSW 9 44248861 missense probably benign 0.01
R4430:Pdzd3 UTSW 9 44249744 missense probably benign
R4433:Pdzd3 UTSW 9 44247988 makesense probably null
R4942:Pdzd3 UTSW 9 44248618 nonsense probably null
R5436:Pdzd3 UTSW 9 44248355 missense possibly damaging 0.79
R6320:Pdzd3 UTSW 9 44248683 missense probably benign 0.00
R6688:Pdzd3 UTSW 9 44248230 critical splice donor site probably null
R7625:Pdzd3 UTSW 9 44250297 missense probably damaging 1.00
R8142:Pdzd3 UTSW 9 44250781 critical splice donor site probably null
R8531:Pdzd3 UTSW 9 44248373 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAACCTGTGGCACCTGAGC -3'
(R):5'- GATAGGCTGGCCATACACATTC -3'

Sequencing Primer
(F):5'- GTCACATACCATGCTGAAGAAG -3'
(R):5'- GGCTGGCCATACACATTCAATTG -3'
Posted On2015-09-24