Incidental Mutation 'R4567:Rtn1'
ID343363
Institutional Source Beutler Lab
Gene Symbol Rtn1
Ensembl Gene ENSMUSG00000021087
Gene Namereticulon 1
SynonymsRtn1-c, 0710005K15Rik, Nsp, Rtn1-b, Rtn1-a, 4930441F12Rik
MMRRC Submission 041791-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4567 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location72211752-72409054 bp(-) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) C to T at 72212487 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120033 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021497] [ENSMUST00000078505] [ENSMUST00000137990]
AlphaFold Q8K0T0
Predicted Effect probably benign
Transcript: ENSMUST00000021497
SMART Domains Protein: ENSMUSP00000021497
Gene: ENSMUSG00000021087

DomainStartEndE-ValueType
Pfam:Reticulon 21 191 1.2e-62 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000078505
SMART Domains Protein: ENSMUSP00000077594
Gene: ENSMUSG00000021087

DomainStartEndE-ValueType
low complexity region 135 152 N/A INTRINSIC
low complexity region 217 226 N/A INTRINSIC
low complexity region 327 341 N/A INTRINSIC
low complexity region 438 448 N/A INTRINSIC
low complexity region 473 480 N/A INTRINSIC
low complexity region 574 586 N/A INTRINSIC
Pfam:Reticulon 593 757 2.2e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137990
SMART Domains Protein: ENSMUSP00000120033
Gene: ENSMUSG00000021087

DomainStartEndE-ValueType
low complexity region 11 32 N/A INTRINSIC
low complexity region 38 50 N/A INTRINSIC
Pfam:Reticulon 66 236 2.3e-61 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150156
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 95% (38/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the family of reticulon encoding genes. Reticulons are associated with the endoplasmic reticulum, and are involved in neuroendocrine secretion or in membrane trafficking in neuroendocrine cells. This gene is considered to be a specific marker for neurological diseases and cancer, and is a potential molecular target for therapy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2011]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T C 1: 26,683,117 D994G probably benign Het
Abhd16a T A 17: 35,096,523 L182Q probably damaging Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Alg12 T C 15: 88,806,353 probably benign Het
Asmt A G X: 170,676,526 probably null Het
Atp10b T C 11: 43,197,557 I330T probably benign Het
Dennd5a T C 7: 109,899,735 M998V probably benign Het
Erbb3 A G 10: 128,579,075 S401P probably damaging Het
Gm10718 A T 9: 3,023,716 T56S probably benign Het
Gm1527 A T 3: 28,914,407 N203Y probably damaging Het
Gm5155 T C 7: 17,908,966 S434P probably damaging Het
Gm6904 A T 14: 59,251,178 Y57N probably damaging Het
Hsf2bp C T 17: 31,946,734 V296M probably benign Het
Htr1d T A 4: 136,443,525 V355E probably benign Het
Ints11 T C 4: 155,885,675 V203A probably damaging Het
Iqsec3 A G 6: 121,387,762 V856A probably damaging Het
Olfr1371 T C 11: 52,213,464 H175R probably damaging Het
Olfr141 A G 2: 86,806,802 S66P probably damaging Het
Olfr694 G A 7: 106,689,213 Q173* probably null Het
Pdzd3 C A 9: 44,249,026 V294L possibly damaging Het
Ppfia2 G A 10: 106,865,406 probably null Het
Prss23 T A 7: 89,510,866 probably benign Het
Rasl2-9 AGG A 7: 5,125,375 probably null Het
Rcn2 A T 9: 56,052,982 I178F probably benign Het
Sik2 A G 9: 50,998,576 V59A probably damaging Het
Slc25a42 A T 8: 70,188,854 M159K probably damaging Het
Slc9a4 T C 1: 40,580,577 L21P probably damaging Het
Smap2 A C 4: 120,985,311 W41G probably damaging Het
Sox6 T C 7: 115,662,322 I220V probably benign Het
Syt17 A G 7: 118,434,272 V171A probably benign Het
Tjp1 A G 7: 65,306,501 F1332S probably damaging Het
Trim3 C T 7: 105,613,416 V512I possibly damaging Het
Uhmk1 G A 1: 170,205,117 Q282* probably null Het
Ushbp1 G A 8: 71,385,717 R648W probably damaging Het
Other mutations in Rtn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00973:Rtn1 APN 12 72408511 missense probably benign 0.18
IGL01335:Rtn1 APN 12 72308350 missense probably benign
IGL01394:Rtn1 APN 12 72308416 missense probably benign 0.00
IGL01551:Rtn1 APN 12 72216935 missense possibly damaging 0.63
IGL01865:Rtn1 APN 12 72219300 missense probably damaging 1.00
IGL02585:Rtn1 APN 12 72308155 critical splice donor site probably null
PIT4802001:Rtn1 UTSW 12 72304326 missense probably benign 0.21
R0104:Rtn1 UTSW 12 72308845 missense probably damaging 0.99
R0866:Rtn1 UTSW 12 72308382 nonsense probably null
R1099:Rtn1 UTSW 12 72304467 splice site probably null
R1438:Rtn1 UTSW 12 72304413 missense probably damaging 0.98
R1610:Rtn1 UTSW 12 72219279 missense possibly damaging 0.90
R1694:Rtn1 UTSW 12 72223524 missense probably damaging 1.00
R1869:Rtn1 UTSW 12 72308168 missense probably damaging 1.00
R1888:Rtn1 UTSW 12 72236533 intron probably benign
R1889:Rtn1 UTSW 12 72304410 missense possibly damaging 0.87
R1892:Rtn1 UTSW 12 72212563 missense probably damaging 1.00
R2418:Rtn1 UTSW 12 72304278 missense probably benign
R2760:Rtn1 UTSW 12 72408362 missense probably benign 0.00
R2973:Rtn1 UTSW 12 72223389 missense probably damaging 1.00
R4880:Rtn1 UTSW 12 72217458 missense possibly damaging 0.88
R4945:Rtn1 UTSW 12 72217484 missense probably damaging 1.00
R6183:Rtn1 UTSW 12 72408491 missense probably benign 0.09
R6493:Rtn1 UTSW 12 72308329 missense probably damaging 0.99
R6547:Rtn1 UTSW 12 72308761 missense possibly damaging 0.59
R6602:Rtn1 UTSW 12 72219318 missense probably damaging 0.99
R7474:Rtn1 UTSW 12 72308390 missense possibly damaging 0.87
R7615:Rtn1 UTSW 12 72304143 missense probably damaging 1.00
R7697:Rtn1 UTSW 12 72408377 missense probably benign 0.32
R7748:Rtn1 UTSW 12 72216926 missense possibly damaging 0.53
R7754:Rtn1 UTSW 12 72308429 missense probably damaging 0.96
R7834:Rtn1 UTSW 12 72304032 missense probably damaging 0.99
R7970:Rtn1 UTSW 12 72308874 missense probably benign 0.06
R8290:Rtn1 UTSW 12 72308419 missense probably benign 0.07
R8311:Rtn1 UTSW 12 72304064 missense probably damaging 1.00
R8440:Rtn1 UTSW 12 72223399 missense probably damaging 1.00
Z1177:Rtn1 UTSW 12 72308864 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GCTACAGAAGCGTTGCAGAG -3'
(R):5'- AGTCAGTAAAGCCACATTATGACC -3'

Sequencing Primer
(F):5'- AACGTGGGCTCTCACCATCATG -3'
(R):5'- CACGCAAAGTGGTTTCATGGGTAC -3'
Posted On2015-09-24