Incidental Mutation 'R4567:Gm6904'
ID343364
Institutional Source Beutler Lab
Gene Symbol Gm6904
Ensembl Gene ENSMUSG00000090881
Gene Namepredicted gene 6904
Synonyms
MMRRC Submission 041791-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R4567 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location59244441-59260216 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 59251178 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 57 (Y57N)
Ref Sequence ENSEMBL: ENSMUSP00000126987 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168702]
Predicted Effect probably damaging
Transcript: ENSMUST00000168702
AA Change: Y57N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126987
Gene: ENSMUSG00000090881
AA Change: Y57N

DomainStartEndE-ValueType
PHD 92 143 5.12e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224042
Meta Mutation Damage Score 0.8723 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 95% (38/40)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T C 1: 26,683,117 D994G probably benign Het
Abhd16a T A 17: 35,096,523 L182Q probably damaging Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Alg12 T C 15: 88,806,353 probably benign Het
Asmt A G X: 170,676,526 probably null Het
Atp10b T C 11: 43,197,557 I330T probably benign Het
Dennd5a T C 7: 109,899,735 M998V probably benign Het
Erbb3 A G 10: 128,579,075 S401P probably damaging Het
Gm10718 A T 9: 3,023,716 T56S probably benign Het
Gm1527 A T 3: 28,914,407 N203Y probably damaging Het
Gm5155 T C 7: 17,908,966 S434P probably damaging Het
Hsf2bp C T 17: 31,946,734 V296M probably benign Het
Htr1d T A 4: 136,443,525 V355E probably benign Het
Ints11 T C 4: 155,885,675 V203A probably damaging Het
Iqsec3 A G 6: 121,387,762 V856A probably damaging Het
Olfr1371 T C 11: 52,213,464 H175R probably damaging Het
Olfr141 A G 2: 86,806,802 S66P probably damaging Het
Olfr694 G A 7: 106,689,213 Q173* probably null Het
Pdzd3 C A 9: 44,249,026 V294L possibly damaging Het
Ppfia2 G A 10: 106,865,406 probably null Het
Prss23 T A 7: 89,510,866 probably benign Het
Rasl2-9 AGG A 7: 5,125,375 probably null Het
Rcn2 A T 9: 56,052,982 I178F probably benign Het
Rtn1 C T 12: 72,212,487 probably benign Het
Sik2 A G 9: 50,998,576 V59A probably damaging Het
Slc25a42 A T 8: 70,188,854 M159K probably damaging Het
Slc9a4 T C 1: 40,580,577 L21P probably damaging Het
Smap2 A C 4: 120,985,311 W41G probably damaging Het
Sox6 T C 7: 115,662,322 I220V probably benign Het
Syt17 A G 7: 118,434,272 V171A probably benign Het
Tjp1 A G 7: 65,306,501 F1332S probably damaging Het
Trim3 C T 7: 105,613,416 V512I possibly damaging Het
Uhmk1 G A 1: 170,205,117 Q282* probably null Het
Ushbp1 G A 8: 71,385,717 R648W probably damaging Het
Other mutations in Gm6904
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01943:Gm6904 APN 14 59251162 missense probably damaging 1.00
IGL01973:Gm6904 APN 14 59251129 missense probably benign
R1297:Gm6904 UTSW 14 59258547 missense probably benign
R1300:Gm6904 UTSW 14 59251114 missense probably damaging 1.00
R1459:Gm6904 UTSW 14 59244778 missense probably damaging 1.00
R1909:Gm6904 UTSW 14 59258613 missense probably benign 0.30
R5024:Gm6904 UTSW 14 59258483 splice site probably null
R5942:Gm6904 UTSW 14 59260144 missense probably benign 0.03
R7736:Gm6904 UTSW 14 59251145 missense probably benign 0.04
R8290:Gm6904 UTSW 14 59247969 missense probably damaging 1.00
R8682:Gm6904 UTSW 14 59258584 missense probably benign 0.14
R8708:Gm6904 UTSW 14 59244813 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACTATCCTTTGACTGTAGCCC -3'
(R):5'- TGCTTGGGTCCAGAGTCAATAGAG -3'

Sequencing Primer
(F):5'- TTTGACTGTAGCCCCCAAGAC -3'
(R):5'- TACAACTGTGTCTGCAGACCGAG -3'
Posted On2015-09-24