Incidental Mutation 'R4571:Csmd2'
ID343367
Institutional Source Beutler Lab
Gene Symbol Csmd2
Ensembl Gene ENSMUSG00000028804
Gene NameCUB and Sushi multiple domains 2
Synonyms
MMRRC Submission 041795-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock #R4571 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location127987857-128567656 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 128480095 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000138958 (fasta)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148247
Predicted Effect probably null
Transcript: ENSMUST00000184063
Predicted Effect probably null
Transcript: ENSMUST00000184063
Predicted Effect probably null
Transcript: ENSMUST00000184063
Predicted Effect probably null
Transcript: ENSMUST00000184063
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (69/69)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T A 6: 96,164,881 N394I probably damaging Het
Abca8a A T 11: 110,030,058 C1497S probably damaging Het
Acoxl G T 2: 127,877,807 G163W probably damaging Het
Apbb1 T A 7: 105,573,762 N214I probably damaging Het
Apol7b T C 15: 77,423,534 K254E probably benign Het
Arl4d T A 11: 101,667,143 V165E possibly damaging Het
Brca1 C A 11: 101,517,366 R1377L probably benign Het
Btf3 A G 13: 98,313,284 F65L probably benign Het
C2 T C 17: 34,863,659 N495D probably benign Het
Cacna1c T C 6: 118,630,380 T1188A probably benign Het
Chd7 C A 4: 8,866,217 D796E probably benign Het
Clasp2 G T 9: 113,847,721 L173F probably damaging Het
Clec4g A T 8: 3,718,766 probably null Het
Col9a3 T C 2: 180,616,366 probably benign Het
Ddx11 T C 17: 66,130,773 C165R probably benign Het
Dnah7c A C 1: 46,533,216 M950L probably damaging Het
Dusp23 A C 1: 172,632,614 probably null Het
Ebag9 A T 15: 44,636,762 probably null Het
Edn3 G A 2: 174,781,904 A211T probably benign Het
Eif3e G A 15: 43,266,162 T190I possibly damaging Het
Fam76a T C 4: 132,920,897 H3R possibly damaging Het
Gabbr1 G T 17: 37,054,236 E138* probably null Het
Galc T C 12: 98,222,617 T412A probably benign Het
Gimap3 T C 6: 48,765,720 D92G possibly damaging Het
Gin1 T C 1: 97,785,076 Y285H probably damaging Het
Gm4868 A G 5: 125,848,718 noncoding transcript Het
Gm7052 T A 17: 22,040,424 probably benign Het
Gpcpd1 T A 2: 132,550,350 E226D probably benign Het
Hoxb4 T C 11: 96,319,166 S133P possibly damaging Het
Hrg C T 16: 22,961,222 probably benign Het
Insrr A G 3: 87,800,887 K212R probably benign Het
Ipp A G 4: 116,530,458 D411G probably damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kcnq3 A G 15: 66,030,612 F172L probably damaging Het
Kdm5d T C Y: 927,110 F616S probably damaging Het
Lars T C 18: 42,228,230 probably null Het
Lmo7 G T 14: 101,887,594 Q496H probably damaging Het
Map3k9 C A 12: 81,734,091 A432S probably benign Het
Nop2 T G 6: 125,140,881 probably null Het
Olfr1029 A T 2: 85,975,831 E196V probably damaging Het
Olfr1115 C A 2: 87,252,458 Q174K possibly damaging Het
Olfr420 A T 1: 174,158,928 N52Y possibly damaging Het
Olfr90 T C 17: 37,085,579 I195M probably damaging Het
Pan2 A G 10: 128,308,643 T187A probably benign Het
Pcmtd2 A G 2: 181,842,424 E9G possibly damaging Het
Pik3cb T A 9: 99,090,257 I283F possibly damaging Het
Pkhd1 G A 1: 20,613,409 T40I probably damaging Het
Plxna2 T C 1: 194,810,988 V1857A possibly damaging Het
Polg T C 7: 79,460,379 S334G probably damaging Het
Rem2 T C 14: 54,477,659 S98P probably damaging Het
Rpl5-ps2 G T 2: 154,704,236 noncoding transcript Het
Slc6a18 A T 13: 73,666,370 N468K possibly damaging Het
Slco4a1 A T 2: 180,464,378 T118S probably benign Het
Smg1 A T 7: 118,139,465 N3520K possibly damaging Het
Tapbp C A 17: 33,926,453 D415E probably damaging Het
Topaz1 A G 9: 122,747,436 T31A probably benign Het
Trpv6 C T 6: 41,621,744 R649H probably damaging Het
Vmn1r188 A G 13: 22,088,518 Y214C probably benign Het
Vps8 T A 16: 21,435,775 I59N probably damaging Het
Wnt9a T C 11: 59,331,337 C354R probably damaging Het
Zcchc2 A G 1: 106,031,257 T1153A possibly damaging Het
Zfp30 A G 7: 29,793,202 R294G probably damaging Het
Zfp558 A T 9: 18,456,503 C330S possibly damaging Het
Zfp62 A C 11: 49,215,741 S220R probably damaging Het
Zfp62 G T 11: 49,215,742 S220I probably damaging Het
Zp3r A G 1: 130,578,020 S423P probably damaging Het
Other mutations in Csmd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Csmd2 APN 4 128483473 missense probably benign 0.03
IGL01098:Csmd2 APN 4 128059052 missense probably damaging 0.99
IGL01114:Csmd2 APN 4 128369130 missense probably benign 0.04
IGL01364:Csmd2 APN 4 128414288 missense probably benign 0.01
IGL01530:Csmd2 APN 4 128414301 missense possibly damaging 0.66
IGL01582:Csmd2 APN 4 128563305 nonsense probably null
IGL01670:Csmd2 APN 4 128513371 splice site probably benign
IGL01707:Csmd2 APN 4 128383005 missense possibly damaging 0.81
IGL01810:Csmd2 APN 4 128480845 splice site probably benign
IGL01837:Csmd2 APN 4 128419570 missense possibly damaging 0.92
IGL01924:Csmd2 APN 4 128559947 missense unknown
IGL02013:Csmd2 APN 4 128321323 missense possibly damaging 0.47
IGL02020:Csmd2 APN 4 128559879 missense probably damaging 1.00
IGL02037:Csmd2 APN 4 128477470 splice site probably benign
IGL02303:Csmd2 APN 4 128369008 missense probably benign 0.01
IGL02317:Csmd2 APN 4 128463727 splice site probably benign
IGL02322:Csmd2 APN 4 128463727 splice site probably benign
IGL02338:Csmd2 APN 4 128395066 missense possibly damaging 0.79
IGL02412:Csmd2 APN 4 128513372 splice site probably benign
IGL02428:Csmd2 APN 4 128474816 missense possibly damaging 0.82
IGL02491:Csmd2 APN 4 128534257 missense probably benign
IGL02701:Csmd2 APN 4 128496141 missense probably benign 0.17
IGL02801:Csmd2 APN 4 128552075 splice site probably null
IGL02818:Csmd2 APN 4 128209728 missense probably damaging 1.00
IGL02863:Csmd2 APN 4 128521884 missense probably benign 0.00
IGL02876:Csmd2 APN 4 128321335 nonsense probably null
IGL02977:Csmd2 APN 4 128493276 nonsense probably null
IGL03006:Csmd2 APN 4 128480765 splice site probably benign
IGL03032:Csmd2 APN 4 128519041 missense probably benign 0.03
IGL03148:Csmd2 APN 4 128384269 missense probably damaging 1.00
IGL03157:Csmd2 APN 4 128414299 nonsense probably null
IGL03245:Csmd2 APN 4 128509122 missense probably benign 0.12
IGL03376:Csmd2 APN 4 128517671 missense probably benign 0.03
IGL03014:Csmd2 UTSW 4 128296429 missense probably benign 0.01
R0109:Csmd2 UTSW 4 128544743 missense probably benign 0.03
R0112:Csmd2 UTSW 4 128496029 missense probably damaging 1.00
R0157:Csmd2 UTSW 4 128521911 missense probably benign 0.02
R0390:Csmd2 UTSW 4 128133673 intron probably benign
R0441:Csmd2 UTSW 4 128520230 missense probably benign 0.00
R0519:Csmd2 UTSW 4 128487005 missense possibly damaging 0.95
R0743:Csmd2 UTSW 4 128113676 missense probably benign 0.00
R0746:Csmd2 UTSW 4 128414297 missense probably damaging 1.00
R0973:Csmd2 UTSW 4 128496188 missense possibly damaging 0.91
R1019:Csmd2 UTSW 4 128522014 missense probably benign 0.00
R1476:Csmd2 UTSW 4 128487001 missense probably benign 0.08
R1641:Csmd2 UTSW 4 128483395 missense possibly damaging 0.68
R1709:Csmd2 UTSW 4 128496195 missense probably damaging 0.96
R2866:Csmd2 UTSW 4 128414392 critical splice donor site probably null
R2870:Csmd2 UTSW 4 128557718 missense unknown
R2870:Csmd2 UTSW 4 128557718 missense unknown
R2871:Csmd2 UTSW 4 128557718 missense unknown
R2871:Csmd2 UTSW 4 128557718 missense unknown
R2872:Csmd2 UTSW 4 128557718 missense unknown
R2872:Csmd2 UTSW 4 128557718 missense unknown
R2873:Csmd2 UTSW 4 128557718 missense unknown
R2893:Csmd2 UTSW 4 128538993 intron probably null
R3796:Csmd2 UTSW 4 128517595 missense probably benign 0.20
R3797:Csmd2 UTSW 4 128517595 missense probably benign 0.20
R3798:Csmd2 UTSW 4 128517595 missense probably benign 0.20
R3914:Csmd2 UTSW 4 128321324 missense probably benign 0.07
R4198:Csmd2 UTSW 4 128510924 missense probably benign 0.07
R4489:Csmd2 UTSW 4 128381945 missense possibly damaging 0.68
R4581:Csmd2 UTSW 4 128369088 missense probably benign 0.02
R4599:Csmd2 UTSW 4 127988128 missense probably benign 0.35
R4649:Csmd2 UTSW 4 128546073 missense probably benign
R4706:Csmd2 UTSW 4 128544751 missense probably benign
R4776:Csmd2 UTSW 4 128442892 missense probably benign 0.09
R4838:Csmd2 UTSW 4 128517749 missense probably benign
R4900:Csmd2 UTSW 4 128452525 missense probably benign 0.03
R4999:Csmd2 UTSW 4 128521930 missense probably benign 0.00
R5024:Csmd2 UTSW 4 128321348 missense possibly damaging 0.94
R5034:Csmd2 UTSW 4 128059108 missense probably damaging 0.98
R5152:Csmd2 UTSW 4 128552035 missense probably benign 0.27
R5172:Csmd2 UTSW 4 128477397 missense probably benign 0.10
R5231:Csmd2 UTSW 4 128546049 missense probably benign 0.00
R5279:Csmd2 UTSW 4 128456914 missense probably benign 0.30
R5287:Csmd2 UTSW 4 128486884 missense probably benign 0.01
R5403:Csmd2 UTSW 4 128486884 missense probably benign 0.01
R5410:Csmd2 UTSW 4 128548819 missense probably benign
R5551:Csmd2 UTSW 4 128510948 missense possibly damaging 0.83
R5566:Csmd2 UTSW 4 128462889 critical splice donor site probably null
R5826:Csmd2 UTSW 4 128519199 splice site probably null
R5907:Csmd2 UTSW 4 128197385 missense probably damaging 0.99
R5913:Csmd2 UTSW 4 128551988 missense probably benign 0.01
R5970:Csmd2 UTSW 4 128546151 missense probably benign 0.00
R5977:Csmd2 UTSW 4 128059034 missense probably damaging 1.00
R6027:Csmd2 UTSW 4 128559946 missense unknown
R6075:Csmd2 UTSW 4 128486865 missense probably benign 0.15
R6129:Csmd2 UTSW 4 128493334 missense possibly damaging 0.79
R6363:Csmd2 UTSW 4 128400379 missense probably benign 0.00
R6366:Csmd2 UTSW 4 128483452 missense probably benign 0.00
R6404:Csmd2 UTSW 4 128521950 missense possibly damaging 0.90
R6437:Csmd2 UTSW 4 127988100 missense probably benign 0.24
R6441:Csmd2 UTSW 4 128394964 missense probably benign 0.03
R6643:Csmd2 UTSW 4 128372597 missense probably benign 0.14
R6724:Csmd2 UTSW 4 128563371 missense probably damaging 0.97
R6734:Csmd2 UTSW 4 128463813 missense probably benign 0.00
R6750:Csmd2 UTSW 4 128197225 missense possibly damaging 0.91
R6801:Csmd2 UTSW 4 128383950 missense probably benign 0.11
R6842:Csmd2 UTSW 4 128509159 missense possibly damaging 0.72
R6843:Csmd2 UTSW 4 128463794 missense probably benign 0.27
R6868:Csmd2 UTSW 4 128442840 missense probably benign
R6882:Csmd2 UTSW 4 128449269 missense probably benign 0.01
R7019:Csmd2 UTSW 4 128369063 missense
R7028:Csmd2 UTSW 4 128277228 missense
R7096:Csmd2 UTSW 4 128462726 missense
R7122:Csmd2 UTSW 4 128449227 missense
R7125:Csmd2 UTSW 4 128496162 missense
R7197:Csmd2 UTSW 4 128511033 missense
R7234:Csmd2 UTSW 4 128456779 missense
R7299:Csmd2 UTSW 4 128528262 missense
R7301:Csmd2 UTSW 4 128528262 missense
R7319:Csmd2 UTSW 4 128393679 missense
R7331:Csmd2 UTSW 4 128564228 splice site probably null
R7332:Csmd2 UTSW 4 128419567 missense
R7352:Csmd2 UTSW 4 128557636 missense
R7402:Csmd2 UTSW 4 128322095 missense
R7402:Csmd2 UTSW 4 128322096 missense
R7474:Csmd2 UTSW 4 128546127 missense
R7555:Csmd2 UTSW 4 128452458 missense
R7592:Csmd2 UTSW 4 128463798 missense
R7700:Csmd2 UTSW 4 128545756 intron probably null
R7714:Csmd2 UTSW 4 128382950 nonsense probably null
R7734:Csmd2 UTSW 4 128552057 missense
R7735:Csmd2 UTSW 4 128456930 critical splice donor site probably null
R7757:Csmd2 UTSW 4 128483456 missense
R7805:Csmd2 UTSW 4 128419573 missense
R7823:Csmd2 UTSW 4 128209905 missense
R7904:Csmd2 UTSW 4 128419553 missense
R7946:Csmd2 UTSW 4 128520265 missense
R7964:Csmd2 UTSW 4 128523510 missense
R7968:Csmd2 UTSW 4 128197325 missense
R8003:Csmd2 UTSW 4 128539187 nonsense probably null
R8071:Csmd2 UTSW 4 128393538 missense
Z1177:Csmd2 UTSW 4 128530797 missense
Predicted Primers PCR Primer
(F):5'- CACCCACAGTTCCTGAAGTG -3'
(R):5'- TCAGGGGACAAATGTCTGCTC -3'

Sequencing Primer
(F):5'- ACAGTTCCTGAAGTGGCACC -3'
(R):5'- GGGACAAATGTCTGCTCCCTAC -3'
Posted On2015-09-24