Mutagenetix > Incidental Mutation

Incidental Mutation 'R4578:Strc'

343377

Institutional Source

Beutler Lab

Gene Symbol

Strc

Ensembl Gene

ENSMUSG00000033498

Gene Name

stereocilin

Synonyms

DFNB16

MMRRC Submission

041800-MU

Accession Numbers

Genbank: NM_080459; MGI: 2153816

Essential gene?

Probably non essential (E-score: 0.222) question?

Stock #

R4578 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

121363728-121387168 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 121378003 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Phenylalanine at position 296 (L296F)

Ref Sequence

ENSEMBL: ENSMUSP00000039378 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038389] [ENSMUST00000129136]

AlphaFold

Q8VIM6

Predicted Effect

possibly damaging
Transcript: ENSMUST00000038389
AA Change: L296F

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000039378
Gene: ENSMUSG00000033498
AA Change: L296F

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
low complexity region	74	87	N/A	INTRINSIC
low complexity region	108	119	N/A	INTRINSIC
low complexity region	132	161	N/A	INTRINSIC
low complexity region	277	291	N/A	INTRINSIC
low complexity region	376	425	N/A	INTRINSIC
low complexity region	610	635	N/A	INTRINSIC
low complexity region	656	677	N/A	INTRINSIC
low complexity region	728	746	N/A	INTRINSIC
low complexity region	898	921	N/A	INTRINSIC
low complexity region	1168	1194	N/A	INTRINSIC
low complexity region	1287	1302	N/A	INTRINSIC
low complexity region	1560	1580	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000129136

SMART Domains

Protein: ENSMUSP00000118211
Gene: ENSMUSG00000033498

Domain	Start	End	E-Value	Type
low complexity region	26	49	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134443

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149219

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150332

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is associated with the hair bundle of the sensory hair cells in the inner ear. The hair bundle is composed of stiff microvilli called stereocilia and is involved with mechanoreception of sound waves. This gene is part of a tandem duplication on chromosome 15; the second copy is a pseudogene. Mutations in this gene cause autosomal recessive non-syndromic deafness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit progressive hearing loss from P15 with abnormal cochlear outer hair cell stereociliary bundle morphology. [provided by MGI curators]

Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930522L14Rik	A	T	5: 109,736,671	Y440*	probably null	Het
Aldh3b3	A	T	19: 3,964,832	T110S	probably benign	Het
Atp2b2	T	C	6: 113,760,711	T901A	probably damaging	Het
Auts2	C	T	5: 132,258,934	G70E	probably benign	Het
Bfar	A	T	16: 13,687,443	I106F	probably benign	Het
Btbd10	T	G	7: 113,322,752	I301L	possibly damaging	Het
Card14	G	A	11: 119,326,741	R400H	probably benign	Het
Ccdc80	A	G	16: 45,095,486	R202G	probably damaging	Het
Cmtm7	A	C	9: 114,763,283	I82S	probably benign	Het
Cngb3	T	A	4: 19,425,613	W474R	probably damaging	Het
Coq9	T	C	8: 94,853,606	V285A	probably benign	Het
Cp	A	G	3: 19,973,888	E486G	probably damaging	Het
Crybg3	C	T	16: 59,530,201	C892Y	probably damaging	Het
Cttn	A	T	7: 144,454,716	F176L	probably damaging	Het
Cytip	T	A	2: 58,160,012	N15I	possibly damaging	Het
Dgkb	A	G	12: 38,427,493	E634G	possibly damaging	Het
Duox1	A	G	2: 122,333,777	E906G	probably benign	Het
Efcab6	A	T	15: 83,933,168	S735T	probably benign	Het
Elfn1	T	C	5: 139,972,053	S271P	probably benign	Het
Ep300	T	C	15: 81,649,009	S1756P	unknown	Het
Ep300	T	A	15: 81,611,410		probably benign	Het
Ercc5	T	A	1: 44,148,148	V29E	probably benign	Het
Fam166a	T	C	2: 25,220,288	S71P	probably benign	Het
Frmd4a	C	A	2: 4,603,679	A786E	possibly damaging	Het
Ftcd	A	C	10: 76,589,258	E524D	probably benign	Het
Gfod2	T	C	8: 105,728,246	M1V	probably null	Het
Gm12790	T	C	4: 101,968,127	D30G	probably benign	Het
Gm7102	C	T	19: 61,175,926	G24R	unknown	Het
Gsta4	A	T	9: 78,206,020	R127S	probably benign	Het
Hcn2	G	A	10: 79,724,448		probably null	Het
Hectd1	A	G	12: 51,751,932	V2135A	probably damaging	Het
Hoxc6	A	G	15: 103,009,661	D19G	probably benign	Het
Hydin	A	T	8: 110,267,339	T2S	unknown	Het
Ifna14	A	T	4: 88,571,510	S97T	possibly damaging	Het
Igkv17-127	T	C	6: 67,861,199	L14P	unknown	Het
Il17rb	A	G	14: 30,002,399	V166A	probably damaging	Het
Iqca	T	A	1: 90,073,750	I520F	probably damaging	Het
Kcnv2	G	T	19: 27,323,594	V282L	probably benign	Het
Klk12	A	G	7: 43,773,243	D198G	probably damaging	Het
Kntc1	T	G	5: 123,765,955	L345R	probably damaging	Het
Lrfn5	A	G	12: 61,843,977	D684G	probably benign	Het
Mef2a	T	C	7: 67,240,439	N131S	probably benign	Het
Mis18bp1	T	C	12: 65,153,881	Y124C	probably damaging	Het
Myh2	T	A	11: 67,173,258	V48D	possibly damaging	Het
Nat10	A	G	2: 103,754,072	M120T	probably damaging	Het
Nf1	T	C	11: 79,445,759	S1065P	probably damaging	Het
Nfib	A	T	4: 82,296,811	S518R	probably damaging	Het
Pced1a	A	C	2: 130,422,676	L78R	probably damaging	Het
Peli3	T	C	19: 4,934,458	D192G	probably benign	Het
Plb1	C	T	5: 32,247,557	Q20*	probably null	Het
Pomgnt2	G	A	9: 121,983,065	R217C	probably damaging	Het
Ptprd	C	T	4: 76,243,786	V78I	possibly damaging	Het
Rngtt	A	G	4: 33,339,050	E285G	probably benign	Het
Sclt1	G	A	3: 41,671,465	Q356*	probably null	Het
Scn2b	T	C	9: 45,126,162	F169S	possibly damaging	Het
Sfta2	C	T	17: 35,649,883		probably benign	Het
Srpr	T	C	9: 35,214,608	I394T	possibly damaging	Het
Sspo	A	C	6: 48,463,373	D1541A	possibly damaging	Het
Svop	C	T	5: 114,065,682	V13M	probably damaging	Het
Taf6l	C	A	19: 8,783,971	R10L	possibly damaging	Het
Tbx3	G	T	5: 119,682,776	R617L	probably damaging	Het
Tnrc6a	A	G	7: 123,184,221	R1471G	possibly damaging	Het
Togaram1	T	C	12: 65,020,326	L1714P	probably damaging	Het
Traf3ip2	A	G	10: 39,634,654	N308D	probably damaging	Het
Trim30b	T	C	7: 104,357,331	Y106C	possibly damaging	Het
Vcp	A	T	4: 42,984,565	M442K	probably benign	Het
Vmn2r16	A	T	5: 109,363,799	Y624F	possibly damaging	Het
Vmn2r52	A	T	7: 10,170,690	H407Q	probably damaging	Het
Vps13a	A	T	19: 16,682,110	D1684E	probably damaging	Het
Wdr49	T	C	3: 75,335,243	M380V	probably benign	Het

Other mutations in Strc

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01102:Strc	APN	2	121365060	missense	probably benign	0.39
IGL01152:Strc	APN	2	121370795	missense	probably benign
IGL01608:Strc	APN	2	121375594	missense	probably benign	0.05
IGL01695:Strc	APN	2	121375298	missense	probably damaging	1.00
IGL01715:Strc	APN	2	121365737	splice site	probably null
IGL01906:Strc	APN	2	121377634	missense	probably benign
IGL02135:Strc	APN	2	121364834	missense	probably damaging	1.00
IGL02416:Strc	APN	2	121369058	missense	probably damaging	1.00
IGL02455:Strc	APN	2	121375791	unclassified	probably benign
IGL03029:Strc	APN	2	121364044	missense	possibly damaging	0.95
IGL03176:Strc	APN	2	121372180	missense	probably damaging	0.99
IGL03272:Strc	APN	2	121371751	missense	probably damaging	1.00
3-1:Strc	UTSW	2	121373680	missense	probably damaging	0.99
IGL02799:Strc	UTSW	2	121379236	missense	probably damaging	1.00
PIT4283001:Strc	UTSW	2	121375307	missense	probably damaging	1.00
R0022:Strc	UTSW	2	121368393	missense	probably damaging	1.00
R0494:Strc	UTSW	2	121379533	missense	probably damaging	0.99
R1065:Strc	UTSW	2	121366651	missense	probably damaging	1.00
R1148:Strc	UTSW	2	121372077	intron	probably benign
R1148:Strc	UTSW	2	121372077	intron	probably benign
R1203:Strc	UTSW	2	121372123	missense	possibly damaging	0.66
R1343:Strc	UTSW	2	121365115	missense	probably benign	0.21
R1544:Strc	UTSW	2	121372738	splice site	probably null
R1650:Strc	UTSW	2	121380885	start gained	probably benign
R1840:Strc	UTSW	2	121379296	missense	probably damaging	1.00
R1983:Strc	UTSW	2	121371037	missense	possibly damaging	0.54
R2035:Strc	UTSW	2	121374934	missense	probably damaging	1.00
R2058:Strc	UTSW	2	121378887	missense	probably damaging	1.00
R2158:Strc	UTSW	2	121365862	missense	probably benign	0.10
R2219:Strc	UTSW	2	121364523	missense	probably damaging	1.00
R2680:Strc	UTSW	2	121365111	missense	probably damaging	0.99
R4375:Strc	UTSW	2	121380823	missense	unknown
R4563:Strc	UTSW	2	121365805	missense	probably benign	0.02
R4607:Strc	UTSW	2	121372945	missense	probably benign	0.31
R4651:Strc	UTSW	2	121374348	missense	possibly damaging	0.67
R4652:Strc	UTSW	2	121374348	missense	possibly damaging	0.67
R4790:Strc	UTSW	2	121375594	missense	probably benign	0.05
R5480:Strc	UTSW	2	121364819	missense	probably benign	0.00
R5580:Strc	UTSW	2	121375012	missense	probably damaging	0.99
R5679:Strc	UTSW	2	121368100	missense	probably benign	0.03
R5703:Strc	UTSW	2	121370814	missense	probably benign
R5841:Strc	UTSW	2	121365877	missense	probably benign	0.29
R5917:Strc	UTSW	2	121379309	missense	probably benign
R5958:Strc	UTSW	2	121376922	missense	possibly damaging	0.56
R6320:Strc	UTSW	2	121374958	missense	probably benign	0.16
R6619:Strc	UTSW	2	121368432	missense	probably damaging	0.99
R6695:Strc	UTSW	2	121377224	missense	probably benign	0.35
R6970:Strc	UTSW	2	121378014	missense	probably benign	0.41
R7018:Strc	UTSW	2	121369058	missense	probably damaging	1.00
R7045:Strc	UTSW	2	121370726	missense	probably damaging	1.00
R7190:Strc	UTSW	2	121369026	missense	probably benign	0.14
R7283:Strc	UTSW	2	121379452	missense	probably damaging	0.99
R7694:Strc	UTSW	2	121377096	missense	probably damaging	1.00
R7699:Strc	UTSW	2	121371748	missense	possibly damaging	0.47
R7700:Strc	UTSW	2	121371748	missense	possibly damaging	0.47
R7756:Strc	UTSW	2	121370946	missense	probably benign
R7758:Strc	UTSW	2	121370946	missense	probably benign
R7822:Strc	UTSW	2	121377738	missense	probably benign	0.01
R7830:Strc	UTSW	2	121375049	missense	probably damaging	0.99
R7953:Strc	UTSW	2	121377363	missense	probably damaging	0.99
R8137:Strc	UTSW	2	121366738	missense	probably damaging	0.98
R8394:Strc	UTSW	2	121379009	missense	probably benign	0.00
R8427:Strc	UTSW	2	121377531	missense	probably damaging	1.00
R8792:Strc	UTSW	2	121377805	missense	probably damaging	0.99
R8874:Strc	UTSW	2	121374872	critical splice donor site	probably null
R8947:Strc	UTSW	2	121370989	missense	probably benign	0.09
R9285:Strc	UTSW	2	121364798	missense	probably damaging	1.00
R9302:Strc	UTSW	2	121380855	missense	unknown
R9386:Strc	UTSW	2	121367730	missense	probably damaging	0.99
R9438:Strc	UTSW	2	121368166	missense	probably damaging	1.00
R9581:Strc	UTSW	2	121377447	missense	probably damaging	0.99
Z1176:Strc	UTSW	2	121375521	missense	probably damaging	0.98
Z1176:Strc	UTSW	2	121379044	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAGGCTTGATGTGCTGGCAG -3'
(R):5'- TAGGCCTTAGTACTGGGGTC -3'

Sequencing Primer
(F):5'- CTCTGGGCCTGAGTGGTTCTC -3'
(R):5'- CAGTACTACCTTTCTTCTTGGGGAG -3'

Posted On

2015-09-24