Incidental Mutation 'R4578:Pced1a'
ID343379
Institutional Source Beutler Lab
Gene Symbol Pced1a
Ensembl Gene ENSMUSG00000037773
Gene NamePC-esterase domain containing 1A
SynonymsFam113a, A930025D01Rik
MMRRC Submission 041800-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4578 (G1)
Quality Score222
Status Not validated
Chromosome2
Chromosomal Location130417247-130424701 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 130422676 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 78 (L78R)
Ref Sequence ENSEMBL: ENSMUSP00000105906 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028900] [ENSMUST00000089581] [ENSMUST00000110277] [ENSMUST00000128994]
Predicted Effect probably benign
Transcript: ENSMUST00000028900
SMART Domains Protein: ENSMUSP00000028900
Gene: ENSMUSG00000027411

DomainStartEndE-ValueType
Pfam:Vps16_N 4 420 1e-166 PFAM
low complexity region 452 462 N/A INTRINSIC
Pfam:Vps16_C 517 835 5.5e-150 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000089581
AA Change: L78R

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000087009
Gene: ENSMUSG00000037773
AA Change: L78R

DomainStartEndE-ValueType
Pfam:PC-Esterase 18 267 4e-52 PFAM
low complexity region 308 346 N/A INTRINSIC
low complexity region 376 391 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110277
AA Change: L78R

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000105906
Gene: ENSMUSG00000037773
AA Change: L78R

DomainStartEndE-ValueType
Pfam:PC-Esterase 21 268 3.8e-51 PFAM
low complexity region 308 346 N/A INTRINSIC
low complexity region 376 391 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123977
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125973
Predicted Effect probably benign
Transcript: ENSMUST00000128994
SMART Domains Protein: ENSMUSP00000115899
Gene: ENSMUSG00000027411

DomainStartEndE-ValueType
Pfam:Vps16_N 4 212 3.2e-74 PFAM
Pfam:Vps16_N 205 316 1e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130258
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131561
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141749
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142536
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153663
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the GDSL/SGNH superfamily. Members of this family are hydrolytic enzymes with esterase and lipase activity and broad substrate specificity. This protein belongs to the Pmr5-Cas1p-esterase subfamily in that it contains the catalytic triad comprised of serine, aspartate and histidine and lacks two conserved regions (glycine after strand S2 and GxND motif). A pseudogene of this gene has been identified on the long arm of chromosome 2. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Sep 2012]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,736,671 Y440* probably null Het
Aldh3b3 A T 19: 3,964,832 T110S probably benign Het
Atp2b2 T C 6: 113,760,711 T901A probably damaging Het
Auts2 C T 5: 132,258,934 G70E probably benign Het
Bfar A T 16: 13,687,443 I106F probably benign Het
Btbd10 T G 7: 113,322,752 I301L possibly damaging Het
Card14 G A 11: 119,326,741 R400H probably benign Het
Ccdc80 A G 16: 45,095,486 R202G probably damaging Het
Cmtm7 A C 9: 114,763,283 I82S probably benign Het
Cngb3 T A 4: 19,425,613 W474R probably damaging Het
Coq9 T C 8: 94,853,606 V285A probably benign Het
Cp A G 3: 19,973,888 E486G probably damaging Het
Crybg3 C T 16: 59,530,201 C892Y probably damaging Het
Cttn A T 7: 144,454,716 F176L probably damaging Het
Cytip T A 2: 58,160,012 N15I possibly damaging Het
Dgkb A G 12: 38,427,493 E634G possibly damaging Het
Duox1 A G 2: 122,333,777 E906G probably benign Het
Efcab6 A T 15: 83,933,168 S735T probably benign Het
Elfn1 T C 5: 139,972,053 S271P probably benign Het
Ep300 T A 15: 81,611,410 probably benign Het
Ep300 T C 15: 81,649,009 S1756P unknown Het
Ercc5 T A 1: 44,148,148 V29E probably benign Het
Fam166a T C 2: 25,220,288 S71P probably benign Het
Frmd4a C A 2: 4,603,679 A786E possibly damaging Het
Ftcd A C 10: 76,589,258 E524D probably benign Het
Gfod2 T C 8: 105,728,246 M1V probably null Het
Gm12790 T C 4: 101,968,127 D30G probably benign Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gsta4 A T 9: 78,206,020 R127S probably benign Het
Hcn2 G A 10: 79,724,448 probably null Het
Hectd1 A G 12: 51,751,932 V2135A probably damaging Het
Hoxc6 A G 15: 103,009,661 D19G probably benign Het
Hydin A T 8: 110,267,339 T2S unknown Het
Ifna14 A T 4: 88,571,510 S97T possibly damaging Het
Igkv17-127 T C 6: 67,861,199 L14P unknown Het
Il17rb A G 14: 30,002,399 V166A probably damaging Het
Iqca T A 1: 90,073,750 I520F probably damaging Het
Kcnv2 G T 19: 27,323,594 V282L probably benign Het
Klk12 A G 7: 43,773,243 D198G probably damaging Het
Kntc1 T G 5: 123,765,955 L345R probably damaging Het
Lrfn5 A G 12: 61,843,977 D684G probably benign Het
Mef2a T C 7: 67,240,439 N131S probably benign Het
Mis18bp1 T C 12: 65,153,881 Y124C probably damaging Het
Myh2 T A 11: 67,173,258 V48D possibly damaging Het
Nat10 A G 2: 103,754,072 M120T probably damaging Het
Nf1 T C 11: 79,445,759 S1065P probably damaging Het
Nfib A T 4: 82,296,811 S518R probably damaging Het
Peli3 T C 19: 4,934,458 D192G probably benign Het
Plb1 C T 5: 32,247,557 Q20* probably null Het
Pomgnt2 G A 9: 121,983,065 R217C probably damaging Het
Ptprd C T 4: 76,243,786 V78I possibly damaging Het
Rngtt A G 4: 33,339,050 E285G probably benign Het
Sclt1 G A 3: 41,671,465 Q356* probably null Het
Scn2b T C 9: 45,126,162 F169S possibly damaging Het
Sfta2 C T 17: 35,649,883 probably benign Het
Srpr T C 9: 35,214,608 I394T possibly damaging Het
Sspo A C 6: 48,463,373 D1541A possibly damaging Het
Strc G A 2: 121,378,003 L296F possibly damaging Het
Svop C T 5: 114,065,682 V13M probably damaging Het
Taf6l C A 19: 8,783,971 R10L possibly damaging Het
Tbx3 G T 5: 119,682,776 R617L probably damaging Het
Tnrc6a A G 7: 123,184,221 R1471G possibly damaging Het
Togaram1 T C 12: 65,020,326 L1714P probably damaging Het
Traf3ip2 A G 10: 39,634,654 N308D probably damaging Het
Trim30b T C 7: 104,357,331 Y106C possibly damaging Het
Vcp A T 4: 42,984,565 M442K probably benign Het
Vmn2r16 A T 5: 109,363,799 Y624F possibly damaging Het
Vmn2r52 A T 7: 10,170,690 H407Q probably damaging Het
Vps13a A T 19: 16,682,110 D1684E probably damaging Het
Wdr49 T C 3: 75,335,243 M380V probably benign Het
Other mutations in Pced1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Pced1a APN 2 130419178 missense probably benign 0.00
IGL02173:Pced1a APN 2 130422328 missense possibly damaging 0.46
IGL02547:Pced1a APN 2 130419707 missense possibly damaging 0.74
IGL02729:Pced1a APN 2 130421903 missense probably benign 0.01
IGL03107:Pced1a APN 2 130422835 missense possibly damaging 0.81
R0139:Pced1a UTSW 2 130421907 missense probably benign 0.00
R0550:Pced1a UTSW 2 130419633 missense probably benign 0.00
R0578:Pced1a UTSW 2 130419843 missense probably damaging 0.98
R3037:Pced1a UTSW 2 130419859 missense probably benign 0.40
R3157:Pced1a UTSW 2 130419767 missense probably benign 0.12
R5306:Pced1a UTSW 2 130419171 missense probably benign
R6210:Pced1a UTSW 2 130421919 missense probably damaging 1.00
R7444:Pced1a UTSW 2 130422059 missense probably damaging 0.98
R7459:Pced1a UTSW 2 130419824 missense possibly damaging 0.59
R7524:Pced1a UTSW 2 130422028 missense probably benign 0.44
R7744:Pced1a UTSW 2 130422052 missense probably damaging 1.00
R7782:Pced1a UTSW 2 130422515 missense probably damaging 0.99
R7851:Pced1a UTSW 2 130422316 missense probably damaging 0.99
R8300:Pced1a UTSW 2 130424237 unclassified probably benign
R8404:Pced1a UTSW 2 130423657 unclassified probably benign
R8502:Pced1a UTSW 2 130423657 unclassified probably benign
Z1177:Pced1a UTSW 2 130422628 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCAGGAGTTGATGATCAC -3'
(R):5'- GTGTATAAGGACCTGGTGCTTC -3'

Sequencing Primer
(F):5'- CAGGAGTTGATGATCACTAGGTC -3'
(R):5'- ATAAGGACCTGGTGCTTCTGCTC -3'
Posted On2015-09-24