Incidental Mutation 'R4578:Tbx3'
ID343399
Institutional Source Beutler Lab
Gene Symbol Tbx3
Ensembl Gene ENSMUSG00000018604
Gene NameT-box 3
SynonymsD5Ertd189e
MMRRC Submission 041800-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4578 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location119670669-119684724 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 119682776 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 617 (R617L)
Ref Sequence ENSEMBL: ENSMUSP00000112519 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018748] [ENSMUST00000079719] [ENSMUST00000121021]
Predicted Effect possibly damaging
Transcript: ENSMUST00000018748
AA Change: R637L

PolyPhen 2 Score 0.871 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000018748
Gene: ENSMUSG00000018604
AA Change: R637L

DomainStartEndE-ValueType
low complexity region 46 63 N/A INTRINSIC
TBOX 102 310 6.4e-125 SMART
Pfam:TBX 323 411 8.8e-29 PFAM
low complexity region 492 510 N/A INTRINSIC
low complexity region 524 538 N/A INTRINSIC
low complexity region 556 576 N/A INTRINSIC
low complexity region 607 620 N/A INTRINSIC
low complexity region 662 710 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000079719
AA Change: R617L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000078657
Gene: ENSMUSG00000018604
AA Change: R617L

DomainStartEndE-ValueType
low complexity region 46 63 N/A INTRINSIC
TBOX 102 290 1.01e-127 SMART
Pfam:TBX 303 391 6.5e-29 PFAM
low complexity region 472 490 N/A INTRINSIC
low complexity region 504 518 N/A INTRINSIC
low complexity region 536 556 N/A INTRINSIC
low complexity region 587 600 N/A INTRINSIC
low complexity region 642 690 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121021
AA Change: R617L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000112519
Gene: ENSMUSG00000018604
AA Change: R617L

DomainStartEndE-ValueType
low complexity region 46 63 N/A INTRINSIC
TBOX 102 290 1.01e-127 SMART
Pfam:TBX 303 391 6.5e-29 PFAM
low complexity region 472 490 N/A INTRINSIC
low complexity region 504 518 N/A INTRINSIC
low complexity region 536 556 N/A INTRINSIC
low complexity region 587 600 N/A INTRINSIC
low complexity region 642 690 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135385
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145647
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154680
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of a phylogenetically conserved family of genes that share a common DNA-binding domain, the T-box. T-box genes encode transcription factors involved in the regulation of developmental processes. This protein is a transcriptional repressor and is thought to play a role in the anterior/posterior axis of the tetrapod forelimb. Mutations in this gene cause ulnar-mammary syndrome, affecting limb, apocrine gland, tooth, hair, and genital development. Alternative splicing of this gene results in three transcript variants encoding different isoforms; however, the full length nature of one variant has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice die are embryonic lethal exhibiting defects in the yolk sac and limb defects. Female embryos show impaired mammary bud induction. Mice homozygous for hypomorphic alleles exhibit varying degrees of prenatal lethality and premature death, heart defects and limb abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,736,671 Y440* probably null Het
Aldh3b3 A T 19: 3,964,832 T110S probably benign Het
Atp2b2 T C 6: 113,760,711 T901A probably damaging Het
Auts2 C T 5: 132,258,934 G70E probably benign Het
Bfar A T 16: 13,687,443 I106F probably benign Het
Btbd10 T G 7: 113,322,752 I301L possibly damaging Het
Card14 G A 11: 119,326,741 R400H probably benign Het
Ccdc80 A G 16: 45,095,486 R202G probably damaging Het
Cmtm7 A C 9: 114,763,283 I82S probably benign Het
Cngb3 T A 4: 19,425,613 W474R probably damaging Het
Coq9 T C 8: 94,853,606 V285A probably benign Het
Cp A G 3: 19,973,888 E486G probably damaging Het
Crybg3 C T 16: 59,530,201 C892Y probably damaging Het
Cttn A T 7: 144,454,716 F176L probably damaging Het
Cytip T A 2: 58,160,012 N15I possibly damaging Het
Dgkb A G 12: 38,427,493 E634G possibly damaging Het
Duox1 A G 2: 122,333,777 E906G probably benign Het
Efcab6 A T 15: 83,933,168 S735T probably benign Het
Elfn1 T C 5: 139,972,053 S271P probably benign Het
Ep300 T A 15: 81,611,410 probably benign Het
Ep300 T C 15: 81,649,009 S1756P unknown Het
Ercc5 T A 1: 44,148,148 V29E probably benign Het
Fam166a T C 2: 25,220,288 S71P probably benign Het
Frmd4a C A 2: 4,603,679 A786E possibly damaging Het
Ftcd A C 10: 76,589,258 E524D probably benign Het
Gfod2 T C 8: 105,728,246 M1V probably null Het
Gm12790 T C 4: 101,968,127 D30G probably benign Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gsta4 A T 9: 78,206,020 R127S probably benign Het
Hcn2 G A 10: 79,724,448 probably null Het
Hectd1 A G 12: 51,751,932 V2135A probably damaging Het
Hoxc6 A G 15: 103,009,661 D19G probably benign Het
Hydin A T 8: 110,267,339 T2S unknown Het
Ifna14 A T 4: 88,571,510 S97T possibly damaging Het
Igkv17-127 T C 6: 67,861,199 L14P unknown Het
Il17rb A G 14: 30,002,399 V166A probably damaging Het
Iqca T A 1: 90,073,750 I520F probably damaging Het
Kcnv2 G T 19: 27,323,594 V282L probably benign Het
Klk12 A G 7: 43,773,243 D198G probably damaging Het
Kntc1 T G 5: 123,765,955 L345R probably damaging Het
Lrfn5 A G 12: 61,843,977 D684G probably benign Het
Mef2a T C 7: 67,240,439 N131S probably benign Het
Mis18bp1 T C 12: 65,153,881 Y124C probably damaging Het
Myh2 T A 11: 67,173,258 V48D possibly damaging Het
Nat10 A G 2: 103,754,072 M120T probably damaging Het
Nf1 T C 11: 79,445,759 S1065P probably damaging Het
Nfib A T 4: 82,296,811 S518R probably damaging Het
Pced1a A C 2: 130,422,676 L78R probably damaging Het
Peli3 T C 19: 4,934,458 D192G probably benign Het
Plb1 C T 5: 32,247,557 Q20* probably null Het
Pomgnt2 G A 9: 121,983,065 R217C probably damaging Het
Ptprd C T 4: 76,243,786 V78I possibly damaging Het
Rngtt A G 4: 33,339,050 E285G probably benign Het
Sclt1 G A 3: 41,671,465 Q356* probably null Het
Scn2b T C 9: 45,126,162 F169S possibly damaging Het
Sfta2 C T 17: 35,649,883 probably benign Het
Srpr T C 9: 35,214,608 I394T possibly damaging Het
Sspo A C 6: 48,463,373 D1541A possibly damaging Het
Strc G A 2: 121,378,003 L296F possibly damaging Het
Svop C T 5: 114,065,682 V13M probably damaging Het
Taf6l C A 19: 8,783,971 R10L possibly damaging Het
Tnrc6a A G 7: 123,184,221 R1471G possibly damaging Het
Togaram1 T C 12: 65,020,326 L1714P probably damaging Het
Traf3ip2 A G 10: 39,634,654 N308D probably damaging Het
Trim30b T C 7: 104,357,331 Y106C possibly damaging Het
Vcp A T 4: 42,984,565 M442K probably benign Het
Vmn2r16 A T 5: 109,363,799 Y624F possibly damaging Het
Vmn2r52 A T 7: 10,170,690 H407Q probably damaging Het
Vps13a A T 19: 16,682,110 D1684E probably damaging Het
Wdr49 T C 3: 75,335,243 M380V probably benign Het
Other mutations in Tbx3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01960:Tbx3 APN 5 119682643 missense probably benign 0.45
IGL02174:Tbx3 APN 5 119675584 nonsense probably null
IGL02508:Tbx3 APN 5 119678812 missense possibly damaging 0.48
IGL03035:Tbx3 APN 5 119683096 utr 3 prime probably benign
R0047:Tbx3 UTSW 5 119680446 missense probably damaging 0.99
R0184:Tbx3 UTSW 5 119675562 missense probably damaging 1.00
R0365:Tbx3 UTSW 5 119675250 missense possibly damaging 0.81
R1209:Tbx3 UTSW 5 119680953 missense probably benign 0.19
R1956:Tbx3 UTSW 5 119680953 missense probably benign 0.19
R2231:Tbx3 UTSW 5 119677524 missense probably damaging 1.00
R4093:Tbx3 UTSW 5 119680748 missense probably benign
R4400:Tbx3 UTSW 5 119680571 missense probably damaging 0.99
R4693:Tbx3 UTSW 5 119677570 missense possibly damaging 0.72
R4716:Tbx3 UTSW 5 119675670 missense possibly damaging 0.94
R4804:Tbx3 UTSW 5 119680512 missense possibly damaging 0.63
R5664:Tbx3 UTSW 5 119678731 missense possibly damaging 0.48
R5724:Tbx3 UTSW 5 119675603 missense possibly damaging 0.75
R5990:Tbx3 UTSW 5 119680529 missense probably benign 0.02
R6133:Tbx3 UTSW 5 119680953 missense probably benign 0.19
R6180:Tbx3 UTSW 5 119674067 missense probably damaging 1.00
R6429:Tbx3 UTSW 5 119674191 nonsense probably null
R7154:Tbx3 UTSW 5 119672028 missense possibly damaging 0.89
R7195:Tbx3 UTSW 5 119675583 missense probably damaging 1.00
R7352:Tbx3 UTSW 5 119677560 missense probably benign 0.00
R7921:Tbx3 UTSW 5 119680869 missense possibly damaging 0.76
R7921:Tbx3 UTSW 5 119680870 missense probably benign 0.01
R8050:Tbx3 UTSW 5 119683067 missense probably benign 0.38
R8089:Tbx3 UTSW 5 119680569 missense probably damaging 0.98
R8422:Tbx3 UTSW 5 119680516 missense possibly damaging 0.94
X0063:Tbx3 UTSW 5 119680881 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGGTTTGCCCCAGATAGTAGG -3'
(R):5'- TGACAAGGACACTGAGCCAG -3'

Sequencing Primer
(F):5'- TGGAGGAGAAGGGTTCCCC -3'
(R):5'- CACTGAGCCAGAGGACAGC -3'
Posted On2015-09-24