Mutagenetix > Incidental Mutation

Incidental Mutation 'R0058:Arnt2'

34341

Institutional Source

Beutler Lab

Gene Symbol

Arnt2

Ensembl Gene

ENSMUSG00000015709

Gene Name

aryl hydrocarbon receptor nuclear translocator 2

Synonyms

bHLHe1

MMRRC Submission

038352-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0058 (G1)

Quality Score

202

Status

Validated

Chromosome

Chromosomal Location

84246278-84410176 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 84347530 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Cysteine at position 63 (R63C)

Ref Sequence

ENSEMBL: ENSMUSP00000146599 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085077] [ENSMUST00000207769] [ENSMUST00000208204] [ENSMUST00000208232] [ENSMUST00000208392] [ENSMUST00000208863] [ENSMUST00000208995] [ENSMUST00000209133]

AlphaFold

Q61324

Predicted Effect

probably damaging
Transcript: ENSMUST00000085077
AA Change: R74C

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000082154
Gene: ENSMUSG00000015709
AA Change: R74C

Domain	Start	End	E-Value	Type
HLH	69	122	1.42e-14	SMART
PAS	137	204	1.28e-8	SMART
low complexity region	225	236	N/A	INTRINSIC
PAS	325	391	4.15e-8	SMART
PAC	398	441	7.93e-5	SMART
low complexity region	502	526	N/A	INTRINSIC
low complexity region	597	626	N/A	INTRINSIC
low complexity region	653	675	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000207512

Predicted Effect

probably damaging
Transcript: ENSMUST00000207769
AA Change: R70C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000208204

Predicted Effect

probably damaging
Transcript: ENSMUST00000208232
AA Change: R63C

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)

Predicted Effect

probably damaging
Transcript: ENSMUST00000208392
AA Change: R59C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000208863
AA Change: R63C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000208995
AA Change: R63C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000209133
AA Change: R63C

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)

Meta Mutation Damage Score

0.9209

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.0%
20x: 94.8%

Validation Efficiency

100% (74/74)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the basic-helix-loop-helix-Per-Arnt-Sim (bHLH-PAS) superfamily of transcription factors. The encoded protein acts as a partner for several sensor proteins of the bHLH-PAS family, forming heterodimers with the sensor proteins that bind regulatory DNA sequences in genes responsive to developmental and environmental stimuli. Under hypoxic conditions, the encoded protein complexes with hypoxia-inducible factor 1alpha in the nucleus and this complex binds to hypoxia-responsive elements in enhancers and promoters of oxygen-responsive genes. A highly similar protein in mouse forms functional complexes with both aryl hydrocarbon receptors and Single-minded proteins, suggesting additional roles for the encoded protein in the metabolism of xenobiotic compounds and the regulation of neurogenesis, respectively. [provided by RefSeq, Dec 2013]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate this gene die shortly after birth, displaying impaired development of secretory neurons in the hypothalamus. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ache	T	G	5: 137,290,842	V270G	probably damaging	Het
Acss1	A	T	2: 150,628,539	W394R	probably damaging	Het
Adgrv1	A	G	13: 81,182,672	V6088A	possibly damaging	Het
Ankrd36	A	G	11: 5,630,691		probably benign	Het
Anxa1	A	T	19: 20,383,777	Y84N	probably damaging	Het
Avpr1b	A	G	1: 131,599,786	T16A	probably benign	Het
Bpifb1	G	A	2: 154,206,540	R165H	possibly damaging	Het
Cables1	A	G	18: 11,923,413	E316G	possibly damaging	Het
Cadm1	A	T	9: 47,850,331	I427L	probably damaging	Het
Ccdc97	T	C	7: 25,715,980	D86G	probably benign	Het
Cgnl1	C	A	9: 71,641,397	D1081Y	probably damaging	Het
Cgnl1	T	A	9: 71,724,840	R410W	probably damaging	Het
Cntnap4	G	A	8: 112,785,784	E593K	probably damaging	Het
Dazap1	T	C	10: 80,261,581		probably benign	Het
Dip2b	A	G	15: 100,215,240	E1512G	probably benign	Het
Dock1	G	A	7: 135,108,761	V1171M	possibly damaging	Het
Dock5	A	T	14: 67,781,036	F1230Y	probably benign	Het
Dym	G	A	18: 75,043,172	E15K	possibly damaging	Het
Ednra	C	A	8: 77,667,322		probably null	Het
Faf1	A	G	4: 109,736,624	Q133R	probably benign	Het
Fbxw28	A	G	9: 109,328,211	I323T	probably benign	Het
Fcer2a	T	C	8: 3,688,111		probably benign	Het
Fmo2	A	T	1: 162,886,324	S204R	probably benign	Het
Frmd4b	A	G	6: 97,423,499	V63A	probably damaging	Het
Fzd8	G	A	18: 9,213,985	A356T	possibly damaging	Het
Ghitm	A	G	14: 37,131,592	L97P	probably damaging	Het
Gins4	A	G	8: 23,229,510		probably benign	Het
Golga3	T	A	5: 110,202,777	F766Y	possibly damaging	Het
Hapln1	T	C	13: 89,607,878	I267T	probably benign	Het
Helz	A	T	11: 107,672,558		probably benign	Het
Herc2	T	C	7: 56,170,483	V2851A	possibly damaging	Het
Igkv8-18	G	A	6: 70,356,121		probably benign	Het
Igll1	A	T	16: 16,863,876	V5E	probably benign	Het
Irx3	T	C	8: 91,800,540	T179A	possibly damaging	Het
Kif16b	A	G	2: 142,857,305		probably null	Het
Limk1	A	T	5: 134,659,871	W507R	probably damaging	Het
Marf1	C	T	16: 14,142,534	A549T	probably damaging	Het
Mtif3	C	A	5: 146,956,921	V159F	probably benign	Het
Myh6	C	T	14: 54,963,404	R169Q	probably damaging	Het
Ncoa7	T	A	10: 30,647,541	D887V	probably damaging	Het
Obox7	C	T	7: 14,664,388	P76S	probably benign	Het
Olfr1335	A	G	4: 118,809,480	M128T	probably benign	Het
Olfr323	A	T	11: 58,625,668	I126N	probably damaging	Het
Pitpnm2	G	A	5: 124,124,030	A862V	probably damaging	Het
Pkd1	G	C	17: 24,564,703	A162P	probably benign	Het
Plce1	A	G	19: 38,525,184	D309G	possibly damaging	Het
Plk4	T	C	3: 40,805,872	V401A	probably benign	Het
Prdx3	T	C	19: 60,874,512		probably benign	Het
Prrc2c	C	T	1: 162,698,884	V253I	unknown	Het
Ranbp2	T	A	10: 58,480,531	S2358T	probably damaging	Het
Setd2	T	A	9: 110,594,426	V2183E	probably damaging	Het
Sgsm1	T	A	5: 113,285,087	S232C	probably damaging	Het
Skint6	A	T	4: 113,046,815		probably benign	Het
Slc15a2	A	G	16: 36,754,547	I531T	probably benign	Het
Slc36a1	C	T	11: 55,221,994		probably benign	Het
Sorbs2	T	A	8: 45,785,254		probably null	Het
Sorbs2	C	A	8: 45,796,263	D831E	probably damaging	Het
Sptan1	T	C	2: 29,993,696		probably null	Het
Stam	T	C	2: 14,138,141	C336R	probably damaging	Het
Stil	G	T	4: 115,041,298	A1042S	probably damaging	Het
Stxbp5l	T	A	16: 37,142,374	D773V	possibly damaging	Het
Sugct	A	T	13: 17,672,581	L39Q	probably damaging	Het
Tep1	A	G	14: 50,834,065	V2041A	possibly damaging	Het
Tex15	C	T	8: 33,581,502		probably benign	Het
Tlr9	T	G	9: 106,224,965	L485R	possibly damaging	Het
Tmem207	A	G	16: 26,524,829		probably benign	Het
Triml2	T	C	8: 43,185,269		probably benign	Het
Trip6	A	G	5: 137,310,845		probably benign	Het
Tspear	T	C	10: 77,869,631	F288L	probably benign	Het
Vmn1r179	C	T	7: 23,929,167	T261I	possibly damaging	Het
Zfp644	A	T	5: 106,637,003	S559R	possibly damaging	Het

Other mutations in Arnt2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01011:Arnt2	APN	7	84285829	missense	probably benign	0.01
IGL01525:Arnt2	APN	7	84275408	missense	possibly damaging	0.70
IGL02331:Arnt2	APN	7	84265624	missense	probably damaging	1.00
IGL02483:Arnt2	APN	7	84251397	missense	probably damaging	1.00
IGL02863:Arnt2	APN	7	84267937	missense	probably damaging	1.00
IGL03207:Arnt2	APN	7	84343834	missense	possibly damaging	0.93
Arnold2	UTSW	7	84347530	missense	probably damaging	1.00
porker	UTSW	7	84343942	missense	probably damaging	1.00
R0024:Arnt2	UTSW	7	84284126	missense	probably benign	0.03
R0058:Arnt2	UTSW	7	84347530	missense	probably damaging	1.00
R0060:Arnt2	UTSW	7	84347530	missense	probably damaging	1.00
R0113:Arnt2	UTSW	7	84347530	missense	probably damaging	1.00
R0114:Arnt2	UTSW	7	84347530	missense	probably damaging	1.00
R0201:Arnt2	UTSW	7	84361659	nonsense	probably null
R0514:Arnt2	UTSW	7	84304859	missense	probably benign	0.00
R0863:Arnt2	UTSW	7	84265584	missense	probably damaging	1.00
R1800:Arnt2	UTSW	7	84275375	missense	probably damaging	1.00
R1944:Arnt2	UTSW	7	84343751	missense	probably benign	0.01
R1964:Arnt2	UTSW	7	84343789	missense	possibly damaging	0.55
R2061:Arnt2	UTSW	7	84343870	missense	probably damaging	1.00
R2216:Arnt2	UTSW	7	84275351	missense	probably damaging	0.99
R3107:Arnt2	UTSW	7	84262444	missense	possibly damaging	0.95
R3410:Arnt2	UTSW	7	84275447	missense	probably damaging	1.00
R3739:Arnt2	UTSW	7	84343801	missense	probably null	1.00
R4258:Arnt2	UTSW	7	84310955	missense	probably damaging	0.98
R4486:Arnt2	UTSW	7	84275345	missense	probably benign	0.03
R4489:Arnt2	UTSW	7	84275345	missense	probably benign	0.03
R4668:Arnt2	UTSW	7	84275386	missense	probably damaging	1.00
R5685:Arnt2	UTSW	7	84263265	missense	probably benign	0.00
R5876:Arnt2	UTSW	7	84347512	missense	probably damaging	1.00
R5923:Arnt2	UTSW	7	84262533	missense	probably benign	0.32
R5926:Arnt2	UTSW	7	84343946	missense	probably damaging	0.99
R6122:Arnt2	UTSW	7	84361565	missense	probably damaging	1.00
R7021:Arnt2	UTSW	7	84343942	missense	probably damaging	1.00
R7895:Arnt2	UTSW	7	84305198	missense	probably benign
R7898:Arnt2	UTSW	7	84268947	splice site	probably null
R8386:Arnt2	UTSW	7	84347539	missense	probably damaging	1.00
R9038:Arnt2	UTSW	7	84304851	missense	probably benign
R9258:Arnt2	UTSW	7	84361590	missense	probably damaging	1.00
R9346:Arnt2	UTSW	7	84282113	missense	probably benign	0.04
R9452:Arnt2	UTSW	7	84284126	missense	probably benign	0.03
R9636:Arnt2	UTSW	7	84343834	missense	probably benign	0.44
R9780:Arnt2	UTSW	7	84305218	missense	probably benign	0.02
X0066:Arnt2	UTSW	7	84285784	missense	possibly damaging	0.93
Z1176:Arnt2	UTSW	7	84263196	missense	probably benign	0.41
Z1177:Arnt2	UTSW	7	84263207	missense	possibly damaging	0.81

Predicted Primers

PCR Primer
(F):5'- TCTGCCACTCTTGAAGAGTACCTCC -3'
(R):5'- TCCATGCTCCCTGGTCAAAAGTCC -3'

Sequencing Primer
(F):5'- CCTCCTTTTGAAGAATGGAAGCC -3'
(R):5'- CCCGAGTTACAGATGTGTCAG -3'

Posted On

2013-05-09