Incidental Mutation 'R4578:Hectd1'
ID343436
Institutional Source Beutler Lab
Gene Symbol Hectd1
Ensembl Gene ENSMUSG00000035247
Gene NameHECT domain E3 ubiquitin protein ligase 1
Synonymsb2b327Clo, opm, A630086P08Rik
MMRRC Submission 041800-MU
Accession Numbers

Genbank: NM_144788; MGI: 2384768

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4578 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location51743722-51829536 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 51751932 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 2135 (V2135A)
Ref Sequence ENSEMBL: ENSMUSP00000046766 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042052] [ENSMUST00000179265]
Predicted Effect probably damaging
Transcript: ENSMUST00000042052
AA Change: V2135A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000046766
Gene: ENSMUSG00000035247
AA Change: V2135A

DomainStartEndE-ValueType
low complexity region 317 331 N/A INTRINSIC
ANK 395 424 1.44e-1 SMART
ANK 426 455 2.81e-4 SMART
ANK 459 488 1.55e2 SMART
low complexity region 490 509 N/A INTRINSIC
low complexity region 630 654 N/A INTRINSIC
low complexity region 707 723 N/A INTRINSIC
low complexity region 821 832 N/A INTRINSIC
Pfam:Sad1_UNC 1107 1240 9.2e-27 PFAM
low complexity region 1259 1271 N/A INTRINSIC
Pfam:MIB_HERC2 1277 1338 7.6e-27 PFAM
low complexity region 1373 1401 N/A INTRINSIC
low complexity region 1441 1458 N/A INTRINSIC
low complexity region 1484 1495 N/A INTRINSIC
low complexity region 1508 1524 N/A INTRINSIC
low complexity region 1600 1630 N/A INTRINSIC
low complexity region 1633 1651 N/A INTRINSIC
low complexity region 1674 1703 N/A INTRINSIC
low complexity region 1745 1752 N/A INTRINSIC
PDB:2LC3|A 1879 1966 4e-57 PDB
low complexity region 2101 2117 N/A INTRINSIC
HECTc 2143 2610 8.32e-76 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000179265
AA Change: V2140A

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000136449
Gene: ENSMUSG00000035247
AA Change: V2140A

DomainStartEndE-ValueType
low complexity region 317 331 N/A INTRINSIC
ANK 396 425 1.44e-1 SMART
ANK 427 456 2.81e-4 SMART
ANK 460 489 1.55e2 SMART
low complexity region 491 510 N/A INTRINSIC
low complexity region 631 655 N/A INTRINSIC
low complexity region 708 724 N/A INTRINSIC
low complexity region 822 833 N/A INTRINSIC
Pfam:Sad1_UNC 1112 1245 1.3e-26 PFAM
low complexity region 1264 1276 N/A INTRINSIC
Pfam:MIB_HERC2 1282 1341 5.3e-26 PFAM
low complexity region 1378 1406 N/A INTRINSIC
low complexity region 1446 1463 N/A INTRINSIC
low complexity region 1489 1500 N/A INTRINSIC
low complexity region 1513 1529 N/A INTRINSIC
low complexity region 1605 1635 N/A INTRINSIC
low complexity region 1638 1656 N/A INTRINSIC
low complexity region 1679 1708 N/A INTRINSIC
low complexity region 1750 1757 N/A INTRINSIC
PDB:2LC3|A 1884 1971 3e-57 PDB
low complexity region 2106 2122 N/A INTRINSIC
HECTc 2148 2618 4.5e-72 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice that are homozygous for either a gene trapped or an ENU-induced allele exhibit exencephaly associated with impaired head mesenchyme development and neural tube closure, and show eye and cranial vault dysplasia. Homozygotes for another ENU-induced allele show congenital cardiovascular defects. [provided by MGI curators]
Allele List at MGI

All alleles(30) : Gene trapped(29) Chemically induced(1)

Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,736,671 Y440* probably null Het
Aldh3b3 A T 19: 3,964,832 T110S probably benign Het
Atp2b2 T C 6: 113,760,711 T901A probably damaging Het
Auts2 C T 5: 132,258,934 G70E probably benign Het
Bfar A T 16: 13,687,443 I106F probably benign Het
Btbd10 T G 7: 113,322,752 I301L possibly damaging Het
Card14 G A 11: 119,326,741 R400H probably benign Het
Ccdc80 A G 16: 45,095,486 R202G probably damaging Het
Cmtm7 A C 9: 114,763,283 I82S probably benign Het
Cngb3 T A 4: 19,425,613 W474R probably damaging Het
Coq9 T C 8: 94,853,606 V285A probably benign Het
Cp A G 3: 19,973,888 E486G probably damaging Het
Crybg3 C T 16: 59,530,201 C892Y probably damaging Het
Cttn A T 7: 144,454,716 F176L probably damaging Het
Cytip T A 2: 58,160,012 N15I possibly damaging Het
Dgkb A G 12: 38,427,493 E634G possibly damaging Het
Duox1 A G 2: 122,333,777 E906G probably benign Het
Efcab6 A T 15: 83,933,168 S735T probably benign Het
Elfn1 T C 5: 139,972,053 S271P probably benign Het
Ep300 T A 15: 81,611,410 probably benign Het
Ep300 T C 15: 81,649,009 S1756P unknown Het
Ercc5 T A 1: 44,148,148 V29E probably benign Het
Fam166a T C 2: 25,220,288 S71P probably benign Het
Frmd4a C A 2: 4,603,679 A786E possibly damaging Het
Ftcd A C 10: 76,589,258 E524D probably benign Het
Gfod2 T C 8: 105,728,246 M1V probably null Het
Gm12790 T C 4: 101,968,127 D30G probably benign Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gsta4 A T 9: 78,206,020 R127S probably benign Het
Hcn2 G A 10: 79,724,448 probably null Het
Hoxc6 A G 15: 103,009,661 D19G probably benign Het
Hydin A T 8: 110,267,339 T2S unknown Het
Ifna14 A T 4: 88,571,510 S97T possibly damaging Het
Igkv17-127 T C 6: 67,861,199 L14P unknown Het
Il17rb A G 14: 30,002,399 V166A probably damaging Het
Iqca T A 1: 90,073,750 I520F probably damaging Het
Kcnv2 G T 19: 27,323,594 V282L probably benign Het
Klk12 A G 7: 43,773,243 D198G probably damaging Het
Kntc1 T G 5: 123,765,955 L345R probably damaging Het
Lrfn5 A G 12: 61,843,977 D684G probably benign Het
Mef2a T C 7: 67,240,439 N131S probably benign Het
Mis18bp1 T C 12: 65,153,881 Y124C probably damaging Het
Myh2 T A 11: 67,173,258 V48D possibly damaging Het
Nat10 A G 2: 103,754,072 M120T probably damaging Het
Nf1 T C 11: 79,445,759 S1065P probably damaging Het
Nfib A T 4: 82,296,811 S518R probably damaging Het
Pced1a A C 2: 130,422,676 L78R probably damaging Het
Peli3 T C 19: 4,934,458 D192G probably benign Het
Plb1 C T 5: 32,247,557 Q20* probably null Het
Pomgnt2 G A 9: 121,983,065 R217C probably damaging Het
Ptprd C T 4: 76,243,786 V78I possibly damaging Het
Rngtt A G 4: 33,339,050 E285G probably benign Het
Sclt1 G A 3: 41,671,465 Q356* probably null Het
Scn2b T C 9: 45,126,162 F169S possibly damaging Het
Sfta2 C T 17: 35,649,883 probably benign Het
Srpr T C 9: 35,214,608 I394T possibly damaging Het
Sspo A C 6: 48,463,373 D1541A possibly damaging Het
Strc G A 2: 121,378,003 L296F possibly damaging Het
Svop C T 5: 114,065,682 V13M probably damaging Het
Taf6l C A 19: 8,783,971 R10L possibly damaging Het
Tbx3 G T 5: 119,682,776 R617L probably damaging Het
Tnrc6a A G 7: 123,184,221 R1471G possibly damaging Het
Togaram1 T C 12: 65,020,326 L1714P probably damaging Het
Traf3ip2 A G 10: 39,634,654 N308D probably damaging Het
Trim30b T C 7: 104,357,331 Y106C possibly damaging Het
Vcp A T 4: 42,984,565 M442K probably benign Het
Vmn2r16 A T 5: 109,363,799 Y624F possibly damaging Het
Vmn2r52 A T 7: 10,170,690 H407Q probably damaging Het
Vps13a A T 19: 16,682,110 D1684E probably damaging Het
Wdr49 T C 3: 75,335,243 M380V probably benign Het
Other mutations in Hectd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Hectd1 APN 12 51769108 missense possibly damaging 0.94
IGL00402:Hectd1 APN 12 51759432 missense probably benign
IGL00419:Hectd1 APN 12 51764035 missense probably damaging 0.99
IGL00518:Hectd1 APN 12 51776489 splice site probably benign
IGL00565:Hectd1 APN 12 51790398 missense probably damaging 0.97
IGL00574:Hectd1 APN 12 51774004 missense probably benign 0.17
IGL00576:Hectd1 APN 12 51759309 missense probably damaging 0.99
IGL00788:Hectd1 APN 12 51748788 missense probably damaging 0.99
IGL00978:Hectd1 APN 12 51791390 missense possibly damaging 0.95
IGL01328:Hectd1 APN 12 51761121 missense probably damaging 1.00
IGL01337:Hectd1 APN 12 51802274 missense possibly damaging 0.95
IGL01634:Hectd1 APN 12 51803779 missense probably damaging 0.98
IGL01731:Hectd1 APN 12 51802810 missense possibly damaging 0.59
IGL01920:Hectd1 APN 12 51782554 missense probably damaging 0.99
IGL01951:Hectd1 APN 12 51794497 nonsense probably null
IGL01994:Hectd1 APN 12 51797942 missense probably damaging 0.99
IGL02140:Hectd1 APN 12 51774137 missense probably damaging 0.99
IGL02150:Hectd1 APN 12 51769191 missense probably damaging 0.97
IGL02156:Hectd1 APN 12 51754133 splice site probably benign
IGL02177:Hectd1 APN 12 51772320 missense probably damaging 0.99
IGL02502:Hectd1 APN 12 51797852 missense possibly damaging 0.77
IGL02505:Hectd1 APN 12 51800713 critical splice donor site probably null
IGL02519:Hectd1 APN 12 51769111 missense probably damaging 0.99
IGL02624:Hectd1 APN 12 51762450 missense possibly damaging 0.61
IGL02833:Hectd1 APN 12 51764081 missense probably damaging 0.96
IGL02851:Hectd1 APN 12 51767640 missense possibly damaging 0.94
IGL02866:Hectd1 APN 12 51790613 missense probably damaging 1.00
IGL02981:Hectd1 APN 12 51768887 missense possibly damaging 0.70
IGL02987:Hectd1 APN 12 51744767 missense probably damaging 1.00
IGL02999:Hectd1 APN 12 51827422 missense possibly damaging 0.77
IGL03071:Hectd1 APN 12 51769174 missense probably benign 0.00
IGL03078:Hectd1 APN 12 51802236 missense probably damaging 0.98
IGL03299:Hectd1 APN 12 51800888 splice site probably benign
3-1:Hectd1 UTSW 12 51753807 missense probably damaging 0.99
R0039:Hectd1 UTSW 12 51753825 missense possibly damaging 0.83
R0238:Hectd1 UTSW 12 51769318 missense possibly damaging 0.72
R0238:Hectd1 UTSW 12 51769318 missense possibly damaging 0.72
R0239:Hectd1 UTSW 12 51769318 missense possibly damaging 0.72
R0239:Hectd1 UTSW 12 51769318 missense possibly damaging 0.72
R0268:Hectd1 UTSW 12 51769107 missense probably damaging 0.99
R0268:Hectd1 UTSW 12 51769108 missense possibly damaging 0.94
R0409:Hectd1 UTSW 12 51782556 missense possibly damaging 0.59
R1019:Hectd1 UTSW 12 51748657 missense probably damaging 0.99
R1072:Hectd1 UTSW 12 51761072 missense probably benign 0.11
R1087:Hectd1 UTSW 12 51776572 missense probably damaging 0.99
R1165:Hectd1 UTSW 12 51764164 splice site probably benign
R1350:Hectd1 UTSW 12 51762434 missense probably benign
R1553:Hectd1 UTSW 12 51773878 missense probably damaging 0.98
R1666:Hectd1 UTSW 12 51753824 missense possibly damaging 0.91
R1676:Hectd1 UTSW 12 51744788 missense probably damaging 1.00
R1694:Hectd1 UTSW 12 51744592 missense probably damaging 1.00
R1778:Hectd1 UTSW 12 51753807 missense probably damaging 0.99
R1856:Hectd1 UTSW 12 51744794 missense probably damaging 1.00
R1859:Hectd1 UTSW 12 51806567 missense probably damaging 1.00
R1884:Hectd1 UTSW 12 51800955 missense probably benign 0.00
R1982:Hectd1 UTSW 12 51785841 missense probably damaging 0.97
R2034:Hectd1 UTSW 12 51757116 splice site probably null
R2061:Hectd1 UTSW 12 51794444 missense probably damaging 0.99
R2078:Hectd1 UTSW 12 51748542 missense probably damaging 0.99
R2176:Hectd1 UTSW 12 51745494 missense probably damaging 1.00
R2210:Hectd1 UTSW 12 51806462 missense probably damaging 0.99
R2248:Hectd1 UTSW 12 51806471 missense probably damaging 0.99
R2282:Hectd1 UTSW 12 51769008 missense possibly damaging 0.95
R2402:Hectd1 UTSW 12 51745534 missense probably benign 0.01
R3876:Hectd1 UTSW 12 51768730 missense probably damaging 0.98
R4027:Hectd1 UTSW 12 51802436 critical splice acceptor site probably null
R4085:Hectd1 UTSW 12 51774750 missense possibly damaging 0.93
R4115:Hectd1 UTSW 12 51768723 nonsense probably null
R4116:Hectd1 UTSW 12 51768723 nonsense probably null
R4169:Hectd1 UTSW 12 51790225 missense probably damaging 0.97
R4434:Hectd1 UTSW 12 51752052 missense probably damaging 1.00
R4507:Hectd1 UTSW 12 51790493 missense probably damaging 0.97
R4579:Hectd1 UTSW 12 51744573 missense probably damaging 0.97
R4709:Hectd1 UTSW 12 51787912 missense possibly damaging 0.94
R4812:Hectd1 UTSW 12 51827351 critical splice donor site probably null
R4883:Hectd1 UTSW 12 51784247 nonsense probably null
R4885:Hectd1 UTSW 12 51800722 missense probably damaging 0.97
R4975:Hectd1 UTSW 12 51762497 missense probably benign 0.02
R4983:Hectd1 UTSW 12 51784262 missense probably benign 0.01
R5007:Hectd1 UTSW 12 51802660 missense possibly damaging 0.95
R5046:Hectd1 UTSW 12 51750388 missense probably damaging 1.00
R5062:Hectd1 UTSW 12 51744879 missense probably damaging 0.98
R5164:Hectd1 UTSW 12 51827489 start codon destroyed probably null 0.60
R5213:Hectd1 UTSW 12 51802533 critical splice donor site probably null
R5535:Hectd1 UTSW 12 51802326 missense probably damaging 0.98
R5776:Hectd1 UTSW 12 51764114 missense possibly damaging 0.91
R5846:Hectd1 UTSW 12 51773835 missense probably damaging 0.99
R5907:Hectd1 UTSW 12 51798754 missense probably damaging 0.98
R5911:Hectd1 UTSW 12 51802252 missense probably damaging 0.99
R5919:Hectd1 UTSW 12 51769072 missense probably damaging 0.98
R6051:Hectd1 UTSW 12 51754104 missense probably benign
R6141:Hectd1 UTSW 12 51746092 critical splice donor site probably null
R6172:Hectd1 UTSW 12 51769282 missense probably damaging 1.00
R6194:Hectd1 UTSW 12 51748445 missense probably damaging 0.99
R6356:Hectd1 UTSW 12 51744619 missense probably damaging 1.00
R6795:Hectd1 UTSW 12 51794487 missense possibly damaging 0.94
R6909:Hectd1 UTSW 12 51764162 splice site probably null
R6971:Hectd1 UTSW 12 51748743 nonsense probably null
R7079:Hectd1 UTSW 12 51787855 missense possibly damaging 0.96
R7104:Hectd1 UTSW 12 51827351 critical splice donor site probably null
R7171:Hectd1 UTSW 12 51759297 missense probably damaging 0.99
R7296:Hectd1 UTSW 12 51785852 missense possibly damaging 0.73
R7346:Hectd1 UTSW 12 51750321 missense probably benign
R7355:Hectd1 UTSW 12 51791298 missense possibly damaging 0.72
R7468:Hectd1 UTSW 12 51744805 splice site probably null
R7531:Hectd1 UTSW 12 51806367 missense probably benign 0.33
R7532:Hectd1 UTSW 12 51790450 missense probably damaging 0.98
R7755:Hectd1 UTSW 12 51802220 missense possibly damaging 0.86
R7807:Hectd1 UTSW 12 51745388 missense probably damaging 1.00
R7842:Hectd1 UTSW 12 51772560 missense probably damaging 0.99
R7922:Hectd1 UTSW 12 51790195 nonsense probably null
R8059:Hectd1 UTSW 12 51790378 missense possibly damaging 0.53
R8085:Hectd1 UTSW 12 51748896 missense probably damaging 0.97
R8145:Hectd1 UTSW 12 51784233 missense possibly damaging 0.72
R8157:Hectd1 UTSW 12 51791290 missense possibly damaging 0.53
R8405:Hectd1 UTSW 12 51827395 missense probably benign 0.01
R8505:Hectd1 UTSW 12 51750362 missense probably damaging 1.00
R8511:Hectd1 UTSW 12 51787871 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATTCTGAGCCACTCTGCCAAG -3'
(R):5'- TTAGCAGTCCACTCAGCTGC -3'

Sequencing Primer
(F):5'- TCTGCCAAGGAGAAAACTTCTG -3'
(R):5'- ACTCAGCTGCTATAAGGACTCTGG -3'
Posted On2015-09-24