Incidental Mutation 'R4578:Lrfn5'
ID343437
Institutional Source Beutler Lab
Gene Symbol Lrfn5
Ensembl Gene ENSMUSG00000035653
Gene Nameleucine rich repeat and fibronectin type III domain containing 5
Synonyms
MMRRC Submission 041800-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R4578 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location61523150-61858342 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 61843977 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 684 (D684G)
Ref Sequence ENSEMBL: ENSMUSP00000113123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055815] [ENSMUST00000119481]
Predicted Effect probably benign
Transcript: ENSMUST00000055815
AA Change: D684G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000051546
Gene: ENSMUSG00000035653
AA Change: D684G

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
LRRNT 19 55 1.11e1 SMART
LRR 74 97 3.07e-1 SMART
LRR_TYP 98 121 1.2e-3 SMART
LRR_TYP 122 145 8.94e-3 SMART
LRR 146 169 6.58e0 SMART
LRR_TYP 170 193 8.34e-3 SMART
LRR 194 218 2.47e1 SMART
LRRCT 240 285 1.65e-2 SMART
IGc2 299 364 3.53e-13 SMART
low complexity region 393 412 N/A INTRINSIC
Blast:FN3 414 495 2e-48 BLAST
transmembrane domain 528 550 N/A INTRINSIC
low complexity region 613 627 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119481
AA Change: D684G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113123
Gene: ENSMUSG00000035653
AA Change: D684G

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
LRRNT 19 55 1.11e1 SMART
LRR 74 97 3.07e-1 SMART
LRR_TYP 98 121 1.2e-3 SMART
LRR_TYP 122 145 8.94e-3 SMART
LRR 146 169 6.58e0 SMART
LRR_TYP 170 193 8.34e-3 SMART
LRR 194 218 2.47e1 SMART
LRRCT 240 285 1.65e-2 SMART
IGc2 299 364 3.53e-13 SMART
low complexity region 393 412 N/A INTRINSIC
Blast:FN3 414 495 2e-48 BLAST
transmembrane domain 528 550 N/A INTRINSIC
low complexity region 613 627 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the leucine-rich repeat and fibronectin type III domain-containing family of proteins. A similar protein in mouse, a glycosylated transmembrane protein, is thought to function in presynaptic differentiation. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,736,671 Y440* probably null Het
Aldh3b3 A T 19: 3,964,832 T110S probably benign Het
Atp2b2 T C 6: 113,760,711 T901A probably damaging Het
Auts2 C T 5: 132,258,934 G70E probably benign Het
Bfar A T 16: 13,687,443 I106F probably benign Het
Btbd10 T G 7: 113,322,752 I301L possibly damaging Het
Card14 G A 11: 119,326,741 R400H probably benign Het
Ccdc80 A G 16: 45,095,486 R202G probably damaging Het
Cmtm7 A C 9: 114,763,283 I82S probably benign Het
Cngb3 T A 4: 19,425,613 W474R probably damaging Het
Coq9 T C 8: 94,853,606 V285A probably benign Het
Cp A G 3: 19,973,888 E486G probably damaging Het
Crybg3 C T 16: 59,530,201 C892Y probably damaging Het
Cttn A T 7: 144,454,716 F176L probably damaging Het
Cytip T A 2: 58,160,012 N15I possibly damaging Het
Dgkb A G 12: 38,427,493 E634G possibly damaging Het
Duox1 A G 2: 122,333,777 E906G probably benign Het
Efcab6 A T 15: 83,933,168 S735T probably benign Het
Elfn1 T C 5: 139,972,053 S271P probably benign Het
Ep300 T A 15: 81,611,410 probably benign Het
Ep300 T C 15: 81,649,009 S1756P unknown Het
Ercc5 T A 1: 44,148,148 V29E probably benign Het
Fam166a T C 2: 25,220,288 S71P probably benign Het
Frmd4a C A 2: 4,603,679 A786E possibly damaging Het
Ftcd A C 10: 76,589,258 E524D probably benign Het
Gfod2 T C 8: 105,728,246 M1V probably null Het
Gm12790 T C 4: 101,968,127 D30G probably benign Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gsta4 A T 9: 78,206,020 R127S probably benign Het
Hcn2 G A 10: 79,724,448 probably null Het
Hectd1 A G 12: 51,751,932 V2135A probably damaging Het
Hoxc6 A G 15: 103,009,661 D19G probably benign Het
Hydin A T 8: 110,267,339 T2S unknown Het
Ifna14 A T 4: 88,571,510 S97T possibly damaging Het
Igkv17-127 T C 6: 67,861,199 L14P unknown Het
Il17rb A G 14: 30,002,399 V166A probably damaging Het
Iqca T A 1: 90,073,750 I520F probably damaging Het
Kcnv2 G T 19: 27,323,594 V282L probably benign Het
Klk12 A G 7: 43,773,243 D198G probably damaging Het
Kntc1 T G 5: 123,765,955 L345R probably damaging Het
Mef2a T C 7: 67,240,439 N131S probably benign Het
Mis18bp1 T C 12: 65,153,881 Y124C probably damaging Het
Myh2 T A 11: 67,173,258 V48D possibly damaging Het
Nat10 A G 2: 103,754,072 M120T probably damaging Het
Nf1 T C 11: 79,445,759 S1065P probably damaging Het
Nfib A T 4: 82,296,811 S518R probably damaging Het
Pced1a A C 2: 130,422,676 L78R probably damaging Het
Peli3 T C 19: 4,934,458 D192G probably benign Het
Plb1 C T 5: 32,247,557 Q20* probably null Het
Pomgnt2 G A 9: 121,983,065 R217C probably damaging Het
Ptprd C T 4: 76,243,786 V78I possibly damaging Het
Rngtt A G 4: 33,339,050 E285G probably benign Het
Sclt1 G A 3: 41,671,465 Q356* probably null Het
Scn2b T C 9: 45,126,162 F169S possibly damaging Het
Sfta2 C T 17: 35,649,883 probably benign Het
Srpr T C 9: 35,214,608 I394T possibly damaging Het
Sspo A C 6: 48,463,373 D1541A possibly damaging Het
Strc G A 2: 121,378,003 L296F possibly damaging Het
Svop C T 5: 114,065,682 V13M probably damaging Het
Taf6l C A 19: 8,783,971 R10L possibly damaging Het
Tbx3 G T 5: 119,682,776 R617L probably damaging Het
Tnrc6a A G 7: 123,184,221 R1471G possibly damaging Het
Togaram1 T C 12: 65,020,326 L1714P probably damaging Het
Traf3ip2 A G 10: 39,634,654 N308D probably damaging Het
Trim30b T C 7: 104,357,331 Y106C possibly damaging Het
Vcp A T 4: 42,984,565 M442K probably benign Het
Vmn2r16 A T 5: 109,363,799 Y624F possibly damaging Het
Vmn2r52 A T 7: 10,170,690 H407Q probably damaging Het
Vps13a A T 19: 16,682,110 D1684E probably damaging Het
Wdr49 T C 3: 75,335,243 M380V probably benign Het
Other mutations in Lrfn5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Lrfn5 APN 12 61844126 missense probably benign
IGL02010:Lrfn5 APN 12 61839683 missense probably damaging 0.96
IGL03033:Lrfn5 APN 12 61840047 missense probably damaging 1.00
IGL03094:Lrfn5 APN 12 61839746 missense probably benign 0.00
IGL03207:Lrfn5 APN 12 61843326 missense probably damaging 1.00
falstaffian UTSW 12 61843562 missense probably benign 0.21
PIT4696001:Lrfn5 UTSW 12 61843557 missense probably damaging 1.00
R0402:Lrfn5 UTSW 12 61840017 missense probably benign 0.22
R0738:Lrfn5 UTSW 12 61840592 nonsense probably null
R0744:Lrfn5 UTSW 12 61839668 missense probably damaging 1.00
R0833:Lrfn5 UTSW 12 61839668 missense probably damaging 1.00
R0973:Lrfn5 UTSW 12 61843437 missense probably damaging 1.00
R0973:Lrfn5 UTSW 12 61843437 missense probably damaging 1.00
R0974:Lrfn5 UTSW 12 61843437 missense probably damaging 1.00
R1073:Lrfn5 UTSW 12 61840809 missense probably damaging 1.00
R1332:Lrfn5 UTSW 12 61857528 splice site probably benign
R1500:Lrfn5 UTSW 12 61839741 missense probably damaging 1.00
R2039:Lrfn5 UTSW 12 61840323 missense possibly damaging 0.82
R3834:Lrfn5 UTSW 12 61840030 missense probably damaging 1.00
R4171:Lrfn5 UTSW 12 61843382 missense probably damaging 1.00
R4212:Lrfn5 UTSW 12 61843820 missense probably benign
R4394:Lrfn5 UTSW 12 61843490 missense probably damaging 1.00
R4661:Lrfn5 UTSW 12 61839647 missense probably damaging 1.00
R4730:Lrfn5 UTSW 12 61840719 missense probably benign 0.03
R4955:Lrfn5 UTSW 12 61839978 missense probably benign 0.29
R4968:Lrfn5 UTSW 12 61839675 missense probably damaging 1.00
R4970:Lrfn5 UTSW 12 61839675 missense probably damaging 1.00
R5078:Lrfn5 UTSW 12 61843874 missense possibly damaging 0.47
R5165:Lrfn5 UTSW 12 61839624 missense possibly damaging 0.89
R5768:Lrfn5 UTSW 12 61839723 missense probably benign 0.44
R5892:Lrfn5 UTSW 12 61843418 missense probably damaging 1.00
R6133:Lrfn5 UTSW 12 61843788 missense probably benign 0.22
R6211:Lrfn5 UTSW 12 61839470 missense probably benign 0.00
R6297:Lrfn5 UTSW 12 61843562 missense probably benign 0.21
R6341:Lrfn5 UTSW 12 61843582 nonsense probably null
R6861:Lrfn5 UTSW 12 61839690 missense probably damaging 1.00
R7179:Lrfn5 UTSW 12 61843982 missense probably benign
R7392:Lrfn5 UTSW 12 61840304 missense probably benign 0.00
R8224:Lrfn5 UTSW 12 61843406 missense possibly damaging 0.91
R8261:Lrfn5 UTSW 12 61839537 missense probably damaging 1.00
Z1177:Lrfn5 UTSW 12 61839817 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGAAACATGTTCGAGTCAGG -3'
(R):5'- AGTGCTAAGTCCACATTGCATTC -3'

Sequencing Primer
(F):5'- AGTCAGGACTCTTCTACCACTAC -3'
(R):5'- GTCCACATTGCATTCATAGACATGC -3'
Posted On2015-09-24