Mutagenetix > Incidental Mutation

Incidental Mutation 'R0058:Tex15'

34345

Institutional Source

Beutler Lab

Gene Symbol

Tex15

Ensembl Gene

ENSMUSG00000009628

Gene Name

testis expressed gene 15

Synonyms

2210014E14Rik

MMRRC Submission

038352-MU

Accession Numbers

NCBI RefSeq: NM_031374.2; MGI: 1934816

Is this an essential gene?

Possibly non essential (E-score: 0.279) question?

Stock #

R0058 (G1)

Quality Score

181

Status

Validated

Chromosome

Chromosomal Location

33516738-33585582 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

C to T at 33581502 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000138070 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000009772] [ENSMUST00000124501]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000009772

SMART Domains

Protein: ENSMUSP00000009772
Gene: ENSMUSG00000009628

Domain	Start	End	E-Value	Type
low complexity region	262	274	N/A	INTRINSIC
low complexity region	302	313	N/A	INTRINSIC
low complexity region	524	536	N/A	INTRINSIC
low complexity region	665	674	N/A	INTRINSIC
low complexity region	713	725	N/A	INTRINSIC
low complexity region	946	961	N/A	INTRINSIC
low complexity region	1497	1508	N/A	INTRINSIC
Pfam:TEX15	1572	1788	1.3e-109	PFAM
Pfam:TEX15	1901	2119	1.1e-16	PFAM
low complexity region	2758	2770	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000124501

SMART Domains

Protein: ENSMUSP00000138070
Gene: ENSMUSG00000009628

Domain	Start	End	E-Value	Type
Pfam:DUF3715	96	251	2.4e-52	PFAM

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.0%
20x: 94.8%

Validation Efficiency

100% (74/74)

MGI Phenotype

Strain: 3526165
PHENOTYPE: Male mice are infertile due to arrest of meiosis stemming from failure to repair double-strand breaks. However, female mice are fertile. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ache	T	G	5: 137,290,842	V270G	probably damaging	Het
Acss1	A	T	2: 150,628,539	W394R	probably damaging	Het
Adgrv1	A	G	13: 81,182,672	V6088A	possibly damaging	Het
Ankrd36	A	G	11: 5,630,691		probably benign	Het
Anxa1	A	T	19: 20,383,777	Y84N	probably damaging	Het
Arnt2	G	A	7: 84,347,530	R63C	probably damaging	Het
Avpr1b	A	G	1: 131,599,786	T16A	probably benign	Het
Bpifb1	G	A	2: 154,206,540	R165H	possibly damaging	Het
Cables1	A	G	18: 11,923,413	E316G	possibly damaging	Het
Cadm1	A	T	9: 47,850,331	I427L	probably damaging	Het
Ccdc97	T	C	7: 25,715,980	D86G	probably benign	Het
Cgnl1	C	A	9: 71,641,397	D1081Y	probably damaging	Het
Cgnl1	T	A	9: 71,724,840	R410W	probably damaging	Het
Cntnap4	G	A	8: 112,785,784	E593K	probably damaging	Het
Dazap1	T	C	10: 80,261,581		probably benign	Het
Dip2b	A	G	15: 100,215,240	E1512G	probably benign	Het
Dock1	G	A	7: 135,108,761	V1171M	possibly damaging	Het
Dock5	A	T	14: 67,781,036	F1230Y	probably benign	Het
Dym	G	A	18: 75,043,172	E15K	possibly damaging	Het
Ednra	C	A	8: 77,667,322		probably null	Het
Faf1	A	G	4: 109,736,624	Q133R	probably benign	Het
Fbxw28	A	G	9: 109,328,211	I323T	probably benign	Het
Fcer2a	T	C	8: 3,688,111		probably benign	Het
Fmo2	A	T	1: 162,886,324	S204R	probably benign	Het
Frmd4b	A	G	6: 97,423,499	V63A	probably damaging	Het
Fzd8	G	A	18: 9,213,985	A356T	possibly damaging	Het
Ghitm	A	G	14: 37,131,592	L97P	probably damaging	Het
Gins4	A	G	8: 23,229,510		probably benign	Het
Golga3	T	A	5: 110,202,777	F766Y	possibly damaging	Het
Hapln1	T	C	13: 89,607,878	I267T	probably benign	Het
Helz	A	T	11: 107,672,558		probably benign	Het
Herc2	T	C	7: 56,170,483	V2851A	possibly damaging	Het
Igkv8-18	G	A	6: 70,356,121		probably benign	Het
Igll1	A	T	16: 16,863,876	V5E	probably benign	Het
Irx3	T	C	8: 91,800,540	T179A	possibly damaging	Het
Kif16b	A	G	2: 142,857,305		probably null	Het
Limk1	A	T	5: 134,659,871	W507R	probably damaging	Het
Marf1	C	T	16: 14,142,534	A549T	probably damaging	Het
Mtif3	C	A	5: 146,956,921	V159F	probably benign	Het
Myh6	C	T	14: 54,963,404	R169Q	probably damaging	Het
Ncoa7	T	A	10: 30,647,541	D887V	probably damaging	Het
Obox7	C	T	7: 14,664,388	P76S	probably benign	Het
Olfr1335	A	G	4: 118,809,480	M128T	probably benign	Het
Olfr323	A	T	11: 58,625,668	I126N	probably damaging	Het
Pitpnm2	G	A	5: 124,124,030	A862V	probably damaging	Het
Pkd1	G	C	17: 24,564,703	A162P	probably benign	Het
Plce1	A	G	19: 38,525,184	D309G	possibly damaging	Het
Plk4	T	C	3: 40,805,872	V401A	probably benign	Het
Prdx3	T	C	19: 60,874,512		probably benign	Het
Prrc2c	C	T	1: 162,698,884	V253I	unknown	Het
Ranbp2	T	A	10: 58,480,531	S2358T	probably damaging	Het
Setd2	T	A	9: 110,594,426	V2183E	probably damaging	Het
Sgsm1	T	A	5: 113,285,087	S232C	probably damaging	Het
Skint6	A	T	4: 113,046,815		probably benign	Het
Slc15a2	A	G	16: 36,754,547	I531T	probably benign	Het
Slc36a1	C	T	11: 55,221,994		probably benign	Het
Sorbs2	T	A	8: 45,785,254		probably null	Het
Sorbs2	C	A	8: 45,796,263	D831E	probably damaging	Het
Sptan1	T	C	2: 29,993,696		probably null	Het
Stam	T	C	2: 14,138,141	C336R	probably damaging	Het
Stil	G	T	4: 115,041,298	A1042S	probably damaging	Het
Stxbp5l	T	A	16: 37,142,374	D773V	possibly damaging	Het
Sugct	A	T	13: 17,672,581	L39Q	probably damaging	Het
Tep1	A	G	14: 50,834,065	V2041A	possibly damaging	Het
Tlr9	T	G	9: 106,224,965	L485R	possibly damaging	Het
Tmem207	A	G	16: 26,524,829		probably benign	Het
Triml2	T	C	8: 43,185,269		probably benign	Het
Trip6	A	G	5: 137,310,845		probably benign	Het
Tspear	T	C	10: 77,869,631	F288L	probably benign	Het
Vmn1r179	C	T	7: 23,929,167	T261I	possibly damaging	Het
Zfp644	A	T	5: 106,637,003	S559R	possibly damaging	Het

Other mutations in Tex15

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00639:Tex15	APN	8	33575311	missense	probably benign	0.18
IGL00705:Tex15	APN	8	33581592	missense	probably damaging	1.00
IGL00820:Tex15	APN	8	33579006	splice site	probably benign
IGL01288:Tex15	APN	8	33571384	missense	probably benign	0.02
IGL01328:Tex15	APN	8	33571396	nonsense	probably null
IGL01359:Tex15	APN	8	33581898	missense	probably damaging	0.99
IGL01603:Tex15	APN	8	33573547	missense	possibly damaging	0.93
IGL01861:Tex15	APN	8	33570689	missense	probably damaging	1.00
IGL02052:Tex15	APN	8	33582465	missense	probably benign	0.28
IGL02560:Tex15	APN	8	33581751	missense	probably benign	0.00
IGL02677:Tex15	APN	8	33571080	missense	probably benign	0.03
IGL02739:Tex15	APN	8	33581693	missense	possibly damaging	0.68
Big_gulp	UTSW	8	33581734	missense	probably damaging	1.00
P0005:Tex15	UTSW	8	33570868	missense	probably benign	0.00
P0037:Tex15	UTSW	8	33581580	missense	probably benign	0.00
PIT4377001:Tex15	UTSW	8	33571101	missense	probably damaging	1.00
R0056:Tex15	UTSW	8	33582027	missense	probably benign	0.00
R0056:Tex15	UTSW	8	33582027	missense	probably benign	0.00
R0058:Tex15	UTSW	8	33581502	splice site	probably benign
R0595:Tex15	UTSW	8	33572617	missense	probably damaging	1.00
R0646:Tex15	UTSW	8	33582326	missense	possibly damaging	0.83
R0688:Tex15	UTSW	8	33573500	missense	probably damaging	1.00
R0842:Tex15	UTSW	8	33571547	missense	possibly damaging	0.95
R0987:Tex15	UTSW	8	33576847	missense	probably damaging	1.00
R1084:Tex15	UTSW	8	33577004	missense	probably benign	0.28
R1183:Tex15	UTSW	8	33574865	missense	probably benign	0.35
R1186:Tex15	UTSW	8	33571633	missense	probably benign	0.19
R1378:Tex15	UTSW	8	33575216	missense	probably damaging	0.99
R1500:Tex15	UTSW	8	33575092	missense	probably damaging	0.96
R1508:Tex15	UTSW	8	33576852	missense	probably damaging	1.00
R1597:Tex15	UTSW	8	33571483	missense	probably damaging	0.96
R1636:Tex15	UTSW	8	33576387	nonsense	probably null
R1639:Tex15	UTSW	8	33570817	missense	possibly damaging	0.94
R1809:Tex15	UTSW	8	33574234	missense	probably benign
R1843:Tex15	UTSW	8	33576654	missense	probably benign	0.27
R2029:Tex15	UTSW	8	33571274	missense	probably damaging	0.99
R2228:Tex15	UTSW	8	33571237	missense	probably benign	0.05
R2229:Tex15	UTSW	8	33571237	missense	probably benign	0.05
R2245:Tex15	UTSW	8	33571496	missense	possibly damaging	0.77
R2246:Tex15	UTSW	8	33582512	missense	possibly damaging	0.49
R2880:Tex15	UTSW	8	33574907	nonsense	probably null
R2881:Tex15	UTSW	8	33574907	nonsense	probably null
R2882:Tex15	UTSW	8	33574907	nonsense	probably null
R3001:Tex15	UTSW	8	33574528	missense	probably benign	0.15
R3002:Tex15	UTSW	8	33574528	missense	probably benign	0.15
R3020:Tex15	UTSW	8	33576670	missense	probably damaging	1.00
R3084:Tex15	UTSW	8	33574885	missense	probably benign	0.11
R3085:Tex15	UTSW	8	33574885	missense	probably benign	0.11
R3701:Tex15	UTSW	8	33574166	missense	probably benign	0.00
R3702:Tex15	UTSW	8	33574166	missense	probably benign	0.00
R3752:Tex15	UTSW	8	33571415	missense	probably benign
R4162:Tex15	UTSW	8	33581558	missense	probably damaging	1.00
R4231:Tex15	UTSW	8	33572137	missense	probably damaging	0.99
R4589:Tex15	UTSW	8	33557373	missense	probably damaging	1.00
R4707:Tex15	UTSW	8	33582497	missense	probably benign	0.00
R4773:Tex15	UTSW	8	33582732	missense	probably benign	0.42
R4967:Tex15	UTSW	8	33574470	missense	probably benign	0.34
R5063:Tex15	UTSW	8	33582610	missense	possibly damaging	0.59
R5121:Tex15	UTSW	8	33571766	missense	probably damaging	1.00
R5147:Tex15	UTSW	8	33572312	nonsense	probably null
R5166:Tex15	UTSW	8	33576392	missense	probably benign	0.07
R5173:Tex15	UTSW	8	33571740	missense	possibly damaging	0.73
R5439:Tex15	UTSW	8	33574171	missense	possibly damaging	0.93
R5537:Tex15	UTSW	8	33571613	missense	probably damaging	1.00
R5580:Tex15	UTSW	8	33572429	missense	probably damaging	1.00
R5588:Tex15	UTSW	8	33577187	missense	probably damaging	1.00
R5696:Tex15	UTSW	8	33573192	missense	probably benign	0.01
R5734:Tex15	UTSW	8	33546336	missense	probably benign	0.01
R5756:Tex15	UTSW	8	33575833	missense	probably benign	0.17
R5823:Tex15	UTSW	8	33570934	missense	possibly damaging	0.67
R6126:Tex15	UTSW	8	33573563	missense	probably benign	0.19
R6129:Tex15	UTSW	8	33574130	missense	possibly damaging	0.90
R6276:Tex15	UTSW	8	33577189	missense	possibly damaging	0.93
R6374:Tex15	UTSW	8	33575912	missense	probably damaging	1.00
R6430:Tex15	UTSW	8	33571301	missense	probably benign	0.01
R6452:Tex15	UTSW	8	33572816	missense	probably damaging	1.00
R6471:Tex15	UTSW	8	33581734	missense	probably damaging	1.00
R6700:Tex15	UTSW	8	33574889	missense	possibly damaging	0.93
R6918:Tex15	UTSW	8	33573184	missense	probably benign	0.27
R6958:Tex15	UTSW	8	33570871	missense	probably benign	0.01
R6970:Tex15	UTSW	8	33557428	missense	probably benign	0.03
R7059:Tex15	UTSW	8	33574730	missense	possibly damaging	0.57
R7069:Tex15	UTSW	8	33570720	missense	probably benign
R7072:Tex15	UTSW	8	33575431	missense	possibly damaging	0.85
R7212:Tex15	UTSW	8	33570826	nonsense	probably null
R7212:Tex15	UTSW	8	33572995	missense	probably damaging	1.00
R7216:Tex15	UTSW	8	33572986	missense	possibly damaging	0.93
R7219:Tex15	UTSW	8	33546240	missense	probably benign	0.40
R7313:Tex15	UTSW	8	33574817	missense	possibly damaging	0.82
R7315:Tex15	UTSW	8	33581516	missense	probably benign	0.01
R7444:Tex15	UTSW	8	33576562	missense	possibly damaging	0.92
R7455:Tex15	UTSW	8	33576997	missense	possibly damaging	0.91
R7643:Tex15	UTSW	8	33575120	missense	probably damaging	1.00
R7644:Tex15	UTSW	8	33574417	missense	probably benign	0.01
R7724:Tex15	UTSW	8	33546263	missense	possibly damaging	0.60
R7779:Tex15	UTSW	8	33575281	missense	probably damaging	1.00
R7798:Tex15	UTSW	8	33581847	missense	possibly damaging	0.69
R7816:Tex15	UTSW	8	33581655	missense	probably benign	0.14
R7820:Tex15	UTSW	8	33575062	missense	probably damaging	0.98
R8041:Tex15	UTSW	8	33575846	missense	probably damaging	1.00
R8150:Tex15	UTSW	8	33573506	missense	probably benign	0.06
R8152:Tex15	UTSW	8	33572893	missense	possibly damaging	0.82
R8237:Tex15	UTSW	8	33577399	missense	possibly damaging	0.72
R8250:Tex15	UTSW	8	33565205	missense	probably null	0.27
R8264:Tex15	UTSW	8	33582362	missense	probably benign	0.18
R8279:Tex15	UTSW	8	33571737	missense	probably damaging	0.96
R8353:Tex15	UTSW	8	33576871	nonsense	probably null
R8388:Tex15	UTSW	8	33575209	missense	probably benign	0.00
R8432:Tex15	UTSW	8	33576544	missense	probably damaging	0.99
R8453:Tex15	UTSW	8	33576871	nonsense	probably null
R8489:Tex15	UTSW	8	33577546	missense	probably benign	0.02
R8670:Tex15	UTSW	8	33574718	missense	probably benign	0.19
R8703:Tex15	UTSW	8	33572696	missense	probably benign	0.00
R8871:Tex15	UTSW	8	33576964	missense	possibly damaging	0.62
R8945:Tex15	UTSW	8	33574696	missense	probably benign	0.00
R9104:Tex15	UTSW	8	33570922	missense	possibly damaging	0.86
R9132:Tex15	UTSW	8	33577526	missense	possibly damaging	0.84
R9207:Tex15	UTSW	8	33575756	missense	probably damaging	1.00
R9210:Tex15	UTSW	8	33574291	missense	possibly damaging	0.91
R9330:Tex15	UTSW	8	33575115	missense	probably benign	0.01
R9354:Tex15	UTSW	8	33573316	missense	possibly damaging	0.86
R9365:Tex15	UTSW	8	33574536	missense	possibly damaging	0.56
R9440:Tex15	UTSW	8	33582245	missense	possibly damaging	0.90
R9534:Tex15	UTSW	8	33570971	missense	probably benign	0.45
R9570:Tex15	UTSW	8	33577281	missense	probably damaging	0.96
R9574:Tex15	UTSW	8	33574481	missense	probably benign	0.09
R9618:Tex15	UTSW	8	33572369	missense	probably benign	0.35
R9655:Tex15	UTSW	8	33576756	nonsense	probably null
R9786:Tex15	UTSW	8	33572429	missense	probably damaging	1.00
R9798:Tex15	UTSW	8	33572693	missense	probably damaging	0.98
RF005:Tex15	UTSW	8	33576677	missense	probably benign	0.05
X0020:Tex15	UTSW	8	33576579	missense	probably benign	0.03
X0065:Tex15	UTSW	8	33575517	nonsense	probably null
Z1088:Tex15	UTSW	8	33571315	missense	possibly damaging	0.89
Z1088:Tex15	UTSW	8	33571810	missense	possibly damaging	0.68
Z1088:Tex15	UTSW	8	33574870	missense	probably benign
Z1176:Tex15	UTSW	8	33574726	missense	possibly damaging	0.84

Predicted Primers

PCR Primer
(F):5'- GGGGACAGGGAAAGATAGCTACTCAT -3'
(R):5'- GTACACTTTCAGCAGGTGACACTGAAC -3'

Sequencing Primer
(F):5'- CAGCCTTCTAACAGTATCAGAAGTG -3'
(R):5'- GGTGACACTGAACCAAGTACTG -3'

Posted On

2013-05-09