Incidental Mutation 'R4578:Vps13a'
ID343452
Institutional Source Beutler Lab
Gene Symbol Vps13a
Ensembl Gene ENSMUSG00000046230
Gene Namevacuolar protein sorting 13A
Synonyms4930516E05Rik, 4930543C13Rik, D330038K10Rik
MMRRC Submission 041800-MU
Accession Numbers

Ncbi RefSeq: NM_173028.4; MGI:2444304

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4578 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location16615366-16780933 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 16682110 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1684 (D1684E)
Ref Sequence ENSEMBL: ENSMUSP00000153129 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068156] [ENSMUST00000224149]
Predicted Effect possibly damaging
Transcript: ENSMUST00000068156
AA Change: D1684E

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000068716
Gene: ENSMUSG00000046230
AA Change: D1684E

DomainStartEndE-ValueType
Pfam:Chorein_N 3 117 5.4e-38 PFAM
Pfam:VPS13 139 371 3.7e-64 PFAM
low complexity region 553 563 N/A INTRINSIC
Pfam:VPS13_mid_rpt 567 791 1.4e-69 PFAM
Pfam:VPS13_mid_rpt 1138 1329 2e-10 PFAM
low complexity region 1367 1377 N/A INTRINSIC
Blast:INB 1575 1855 1e-149 BLAST
Pfam:SHR-BD 2200 2449 1.3e-35 PFAM
low complexity region 2510 2521 N/A INTRINSIC
low complexity region 2632 2648 N/A INTRINSIC
low complexity region 2719 2731 N/A INTRINSIC
Pfam:VPS13_C 2755 2935 8.9e-66 PFAM
Pfam:ATG_C 2938 3029 1.6e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223897
Predicted Effect probably damaging
Transcript: ENSMUST00000224149
AA Change: D1684E

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225349
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype Strain: 3531502
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene may control steps in the cycling of proteins through the trans-Golgi network to endosomes, lysosomes and the plasma membrane. Mutations in this gene cause the autosomal recessive disorder, chorea-acanthocytosis. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Aging mice homozygous for a knock-out allele display motor dysfunction and abnormal social interaction, hematologic anomalies including acanthocytosis, selective atrophy of the striatum with significant apoptosis and gliosis, and reduced homovanillic acid levels in midbrain. [provided by MGI curators]
Allele List at MGI

All alleles(8) : Targeted(3) Gene trapped(5)

Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,736,671 Y440* probably null Het
Aldh3b3 A T 19: 3,964,832 T110S probably benign Het
Atp2b2 T C 6: 113,760,711 T901A probably damaging Het
Auts2 C T 5: 132,258,934 G70E probably benign Het
Bfar A T 16: 13,687,443 I106F probably benign Het
Btbd10 T G 7: 113,322,752 I301L possibly damaging Het
Card14 G A 11: 119,326,741 R400H probably benign Het
Ccdc80 A G 16: 45,095,486 R202G probably damaging Het
Cmtm7 A C 9: 114,763,283 I82S probably benign Het
Cngb3 T A 4: 19,425,613 W474R probably damaging Het
Coq9 T C 8: 94,853,606 V285A probably benign Het
Cp A G 3: 19,973,888 E486G probably damaging Het
Crybg3 C T 16: 59,530,201 C892Y probably damaging Het
Cttn A T 7: 144,454,716 F176L probably damaging Het
Cytip T A 2: 58,160,012 N15I possibly damaging Het
Dgkb A G 12: 38,427,493 E634G possibly damaging Het
Duox1 A G 2: 122,333,777 E906G probably benign Het
Efcab6 A T 15: 83,933,168 S735T probably benign Het
Elfn1 T C 5: 139,972,053 S271P probably benign Het
Ep300 T A 15: 81,611,410 probably benign Het
Ep300 T C 15: 81,649,009 S1756P unknown Het
Ercc5 T A 1: 44,148,148 V29E probably benign Het
Fam166a T C 2: 25,220,288 S71P probably benign Het
Frmd4a C A 2: 4,603,679 A786E possibly damaging Het
Ftcd A C 10: 76,589,258 E524D probably benign Het
Gfod2 T C 8: 105,728,246 M1V probably null Het
Gm12790 T C 4: 101,968,127 D30G probably benign Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gsta4 A T 9: 78,206,020 R127S probably benign Het
Hcn2 G A 10: 79,724,448 probably null Het
Hectd1 A G 12: 51,751,932 V2135A probably damaging Het
Hoxc6 A G 15: 103,009,661 D19G probably benign Het
Hydin A T 8: 110,267,339 T2S unknown Het
Ifna14 A T 4: 88,571,510 S97T possibly damaging Het
Igkv17-127 T C 6: 67,861,199 L14P unknown Het
Il17rb A G 14: 30,002,399 V166A probably damaging Het
Iqca T A 1: 90,073,750 I520F probably damaging Het
Kcnv2 G T 19: 27,323,594 V282L probably benign Het
Klk12 A G 7: 43,773,243 D198G probably damaging Het
Kntc1 T G 5: 123,765,955 L345R probably damaging Het
Lrfn5 A G 12: 61,843,977 D684G probably benign Het
Mef2a T C 7: 67,240,439 N131S probably benign Het
Mis18bp1 T C 12: 65,153,881 Y124C probably damaging Het
Myh2 T A 11: 67,173,258 V48D possibly damaging Het
Nat10 A G 2: 103,754,072 M120T probably damaging Het
Nf1 T C 11: 79,445,759 S1065P probably damaging Het
Nfib A T 4: 82,296,811 S518R probably damaging Het
Pced1a A C 2: 130,422,676 L78R probably damaging Het
Peli3 T C 19: 4,934,458 D192G probably benign Het
Plb1 C T 5: 32,247,557 Q20* probably null Het
Pomgnt2 G A 9: 121,983,065 R217C probably damaging Het
Ptprd C T 4: 76,243,786 V78I possibly damaging Het
Rngtt A G 4: 33,339,050 E285G probably benign Het
Sclt1 G A 3: 41,671,465 Q356* probably null Het
Scn2b T C 9: 45,126,162 F169S possibly damaging Het
Sfta2 C T 17: 35,649,883 probably benign Het
Srpr T C 9: 35,214,608 I394T possibly damaging Het
Sspo A C 6: 48,463,373 D1541A possibly damaging Het
Strc G A 2: 121,378,003 L296F possibly damaging Het
Svop C T 5: 114,065,682 V13M probably damaging Het
Taf6l C A 19: 8,783,971 R10L possibly damaging Het
Tbx3 G T 5: 119,682,776 R617L probably damaging Het
Tnrc6a A G 7: 123,184,221 R1471G possibly damaging Het
Togaram1 T C 12: 65,020,326 L1714P probably damaging Het
Traf3ip2 A G 10: 39,634,654 N308D probably damaging Het
Trim30b T C 7: 104,357,331 Y106C possibly damaging Het
Vcp A T 4: 42,984,565 M442K probably benign Het
Vmn2r16 A T 5: 109,363,799 Y624F possibly damaging Het
Vmn2r52 A T 7: 10,170,690 H407Q probably damaging Het
Wdr49 T C 3: 75,335,243 M380V probably benign Het
Other mutations in Vps13a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Vps13a APN 19 16752175 missense probably damaging 0.98
IGL00537:Vps13a APN 19 16680045 missense probably benign 0.03
IGL00562:Vps13a APN 19 16734714 critical splice donor site probably null
IGL00563:Vps13a APN 19 16734714 critical splice donor site probably null
IGL00579:Vps13a APN 19 16707362 missense probably benign 0.29
IGL00662:Vps13a APN 19 16704540 missense probably damaging 0.96
IGL00667:Vps13a APN 19 16759676 missense probably damaging 1.00
IGL01102:Vps13a APN 19 16651417 critical splice donor site probably null
IGL01139:Vps13a APN 19 16640625 missense probably damaging 0.99
IGL01142:Vps13a APN 19 16687115 missense possibly damaging 0.86
IGL01361:Vps13a APN 19 16743007 missense probably damaging 1.00
IGL01386:Vps13a APN 19 16701152 missense possibly damaging 0.87
IGL01593:Vps13a APN 19 16762181 missense probably damaging 0.98
IGL01700:Vps13a APN 19 16744857 nonsense probably null
IGL01767:Vps13a APN 19 16663894 missense probably damaging 1.00
IGL01782:Vps13a APN 19 16754337 missense probably damaging 0.98
IGL01808:Vps13a APN 19 16710286 missense probably damaging 1.00
IGL01812:Vps13a APN 19 16715060 missense probably benign
IGL01829:Vps13a APN 19 16619443 missense probably benign 0.01
IGL01893:Vps13a APN 19 16663775 missense probably damaging 1.00
IGL02222:Vps13a APN 19 16682175 missense probably benign 0.06
IGL02295:Vps13a APN 19 16715042 splice site probably benign
IGL02465:Vps13a APN 19 16710941 missense probably benign 0.11
IGL02492:Vps13a APN 19 16647637 missense probably damaging 1.00
IGL02581:Vps13a APN 19 16655322 missense probably benign 0.41
IGL02633:Vps13a APN 19 16720408 missense possibly damaging 0.82
IGL02641:Vps13a APN 19 16698821 missense probably benign 0.01
IGL02659:Vps13a APN 19 16652699 missense probably damaging 1.00
IGL02827:Vps13a APN 19 16641634 missense possibly damaging 0.91
IGL02943:Vps13a APN 19 16663886 missense probably damaging 1.00
IGL03057:Vps13a APN 19 16668694 missense probably damaging 1.00
IGL03077:Vps13a APN 19 16710882 missense probably benign
IGL03184:Vps13a APN 19 16654370 missense probably benign 0.00
eggs UTSW 19 16701165 missense probably damaging 1.00
excambio UTSW 19 16745947 splice site probably null
Faster UTSW 19 16619485 missense probably damaging 1.00
Ham UTSW 19 16677969 missense probably benign 0.08
interchange UTSW 19 16668690 missense probably damaging 1.00
PIT4377001:Vps13a UTSW 19 16740901 missense probably damaging 1.00
R0045:Vps13a UTSW 19 16640810 nonsense probably null
R0045:Vps13a UTSW 19 16640810 nonsense probably null
R0048:Vps13a UTSW 19 16676140 missense probably damaging 1.00
R0062:Vps13a UTSW 19 16668690 missense probably damaging 1.00
R0062:Vps13a UTSW 19 16668690 missense probably damaging 1.00
R0107:Vps13a UTSW 19 16691824 missense probably benign 0.03
R0135:Vps13a UTSW 19 16780765 missense probably damaging 1.00
R0138:Vps13a UTSW 19 16660499 missense possibly damaging 0.95
R0346:Vps13a UTSW 19 16677969 missense probably benign 0.08
R0359:Vps13a UTSW 19 16641577 missense probably damaging 0.99
R0530:Vps13a UTSW 19 16655206 splice site probably benign
R0541:Vps13a UTSW 19 16704577 missense probably benign 0.00
R0614:Vps13a UTSW 19 16652694 missense probably damaging 1.00
R0685:Vps13a UTSW 19 16780741 missense probably damaging 1.00
R0801:Vps13a UTSW 19 16686656 splice site probably benign
R0835:Vps13a UTSW 19 16734882 splice site probably null
R0848:Vps13a UTSW 19 16698897 missense probably damaging 1.00
R1114:Vps13a UTSW 19 16750151 missense probably benign 0.41
R1205:Vps13a UTSW 19 16640541 missense probably damaging 1.00
R1365:Vps13a UTSW 19 16619446 missense probably damaging 1.00
R1445:Vps13a UTSW 19 16701238 nonsense probably null
R1451:Vps13a UTSW 19 16710864 missense probably benign 0.01
R1479:Vps13a UTSW 19 16750114 splice site probably benign
R1533:Vps13a UTSW 19 16701130 nonsense probably null
R1600:Vps13a UTSW 19 16666272 missense probably benign 0.01
R1870:Vps13a UTSW 19 16759952 missense probably damaging 1.00
R1871:Vps13a UTSW 19 16664664 missense probably benign 0.01
R1959:Vps13a UTSW 19 16677938 missense possibly damaging 0.49
R1960:Vps13a UTSW 19 16725631 missense probably damaging 1.00
R1993:Vps13a UTSW 19 16722458 missense probably benign 0.07
R2257:Vps13a UTSW 19 16682174 missense possibly damaging 0.85
R2276:Vps13a UTSW 19 16710426 missense possibly damaging 0.47
R2326:Vps13a UTSW 19 16743057 missense possibly damaging 0.71
R2338:Vps13a UTSW 19 16720453 missense probably damaging 1.00
R2359:Vps13a UTSW 19 16652679 splice site probably benign
R2421:Vps13a UTSW 19 16759671 missense probably benign
R2847:Vps13a UTSW 19 16703599 missense probably damaging 0.98
R3081:Vps13a UTSW 19 16664737 missense probably benign 0.02
R3522:Vps13a UTSW 19 16766493 splice site probably benign
R3613:Vps13a UTSW 19 16685402 missense probably damaging 1.00
R3797:Vps13a UTSW 19 16745947 splice site probably null
R3874:Vps13a UTSW 19 16744953 missense probably benign 0.01
R4032:Vps13a UTSW 19 16616899 missense probably damaging 1.00
R4111:Vps13a UTSW 19 16640628 missense probably damaging 1.00
R4383:Vps13a UTSW 19 16701165 missense probably damaging 1.00
R4504:Vps13a UTSW 19 16695502 missense possibly damaging 0.93
R4587:Vps13a UTSW 19 16640039 missense probably damaging 1.00
R4588:Vps13a UTSW 19 16640039 missense probably damaging 1.00
R4605:Vps13a UTSW 19 16640039 missense probably damaging 1.00
R4714:Vps13a UTSW 19 16749856 missense probably benign 0.01
R4756:Vps13a UTSW 19 16655216 missense probably benign 0.01
R4831:Vps13a UTSW 19 16677992 missense probably benign 0.04
R5068:Vps13a UTSW 19 16746058 missense probably benign 0.01
R5070:Vps13a UTSW 19 16654484 missense probably benign
R5082:Vps13a UTSW 19 16744893 missense probably damaging 1.00
R5182:Vps13a UTSW 19 16695499 missense possibly damaging 0.81
R5189:Vps13a UTSW 19 16685315 missense probably damaging 1.00
R5283:Vps13a UTSW 19 16677970 missense probably damaging 0.96
R5294:Vps13a UTSW 19 16641667 missense probably damaging 1.00
R5304:Vps13a UTSW 19 16710387 missense possibly damaging 0.78
R5554:Vps13a UTSW 19 16722411 missense probably damaging 1.00
R5592:Vps13a UTSW 19 16725571 missense probably damaging 1.00
R5611:Vps13a UTSW 19 16725572 missense probably damaging 1.00
R5665:Vps13a UTSW 19 16668690 missense probably damaging 1.00
R5671:Vps13a UTSW 19 16715100 missense probably benign 0.03
R5684:Vps13a UTSW 19 16699045 missense probably benign 0.00
R5767:Vps13a UTSW 19 16664564 missense probably damaging 1.00
R5810:Vps13a UTSW 19 16666324 missense probably benign 0.00
R5866:Vps13a UTSW 19 16680023 missense probably benign 0.04
R5886:Vps13a UTSW 19 16664562 missense probably benign 0.01
R5933:Vps13a UTSW 19 16660530 missense probably benign 0.34
R5965:Vps13a UTSW 19 16619028 splice site probably null
R6259:Vps13a UTSW 19 16687170 nonsense probably null
R6346:Vps13a UTSW 19 16682214 missense possibly damaging 0.94
R6459:Vps13a UTSW 19 16664018 missense possibly damaging 0.56
R6485:Vps13a UTSW 19 16680050 missense probably damaging 0.99
R6520:Vps13a UTSW 19 16725579 missense probably damaging 1.00
R6644:Vps13a UTSW 19 16744919 missense possibly damaging 0.90
R6932:Vps13a UTSW 19 16678075 missense probably benign 0.01
R6934:Vps13a UTSW 19 16676194 missense probably damaging 1.00
R6951:Vps13a UTSW 19 16723740 missense probably benign 0.00
R7027:Vps13a UTSW 19 16664664 missense probably benign 0.01
R7126:Vps13a UTSW 19 16710879 missense probably benign
R7206:Vps13a UTSW 19 16754298 missense probably damaging 1.00
R7248:Vps13a UTSW 19 16678042 missense probably benign 0.25
R7252:Vps13a UTSW 19 16661064 missense probably benign 0.00
R7255:Vps13a UTSW 19 16654339 critical splice donor site probably null
R7382:Vps13a UTSW 19 16619485 missense probably damaging 1.00
R7422:Vps13a UTSW 19 16750173 missense probably damaging 1.00
R7425:Vps13a UTSW 19 16723702 missense probably benign 0.13
R7523:Vps13a UTSW 19 16703789 missense probably benign
R7586:Vps13a UTSW 19 16647598 missense probably benign 0.08
R7587:Vps13a UTSW 19 16703789 missense probably benign 0.00
R7593:Vps13a UTSW 19 16725663 missense probably damaging 1.00
R7637:Vps13a UTSW 19 16750149 missense probably benign 0.02
R7763:Vps13a UTSW 19 16746000 missense possibly damaging 0.95
R7813:Vps13a UTSW 19 16651456 missense possibly damaging 0.81
R7815:Vps13a UTSW 19 16725572 missense probably damaging 1.00
R7861:Vps13a UTSW 19 16655304 missense probably damaging 1.00
R7909:Vps13a UTSW 19 16720430 nonsense probably null
R7939:Vps13a UTSW 19 16740791 missense possibly damaging 0.94
R8108:Vps13a UTSW 19 16640787 missense probably damaging 1.00
R8123:Vps13a UTSW 19 16647702 missense probably benign 0.01
R8134:Vps13a UTSW 19 16654354 missense possibly damaging 0.71
R8168:Vps13a UTSW 19 16749548 missense probably benign 0.09
R8272:Vps13a UTSW 19 16749845 critical splice donor site probably null
R8293:Vps13a UTSW 19 16668605 missense possibly damaging 0.81
R8303:Vps13a UTSW 19 16616906 missense probably benign 0.00
R8383:Vps13a UTSW 19 16723705 missense possibly damaging 0.83
R8386:Vps13a UTSW 19 16701119 critical splice donor site probably null
R8433:Vps13a UTSW 19 16741236 missense possibly damaging 0.56
R8436:Vps13a UTSW 19 16740793 missense probably benign 0.10
R8450:Vps13a UTSW 19 16654507 splice site probably null
R8501:Vps13a UTSW 19 16682120 missense probably benign 0.39
X0061:Vps13a UTSW 19 16645868 missense probably benign 0.40
X0066:Vps13a UTSW 19 16742553 missense probably benign 0.33
Z1177:Vps13a UTSW 19 16699113 critical splice acceptor site probably null
Z31818:Vps13a UTSW 19 16780754 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TCCAGTTCCAGGTGACAGTG -3'
(R):5'- GCACTTGTAGCATTTACTGGG -3'

Sequencing Primer
(F):5'- AGAGAGAGCCAGTTTTTGCTTTCC -3'
(R):5'- AATGGAAACCTCATGATATGTGC -3'
Posted On2015-09-24