Incidental Mutation 'R4573:Atad2b'
ID 343453
Institutional Source Beutler Lab
Gene Symbol Atad2b
Ensembl Gene ENSMUSG00000052812
Gene Name ATPase family, AAA domain containing 2B
Synonyms D530031C13Rik, 1110014E10Rik
MMRRC Submission 041598-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4573 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 4917353-5047394 bp(+) (GRCm38)
Type of Mutation splice site (6 bp from exon)
DNA Base Change (assembly) T to C at 4954663 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000047445 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045664]
AlphaFold E9Q166
Predicted Effect probably null
Transcript: ENSMUST00000045664
SMART Domains Protein: ENSMUSP00000047445
Gene: ENSMUSG00000052812

DomainStartEndE-ValueType
low complexity region 13 54 N/A INTRINSIC
low complexity region 135 146 N/A INTRINSIC
low complexity region 231 242 N/A INTRINSIC
low complexity region 252 278 N/A INTRINSIC
AAA 432 573 4.56e-20 SMART
SCOP:d1e32a2 771 912 3e-4 SMART
BROMO 958 1070 4.24e-20 SMART
low complexity region 1135 1144 N/A INTRINSIC
low complexity region 1230 1253 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218303
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the AAA ATPase family. This family member includes an N-terminal bromodomain. It has been found to be localized to the nucleus, partly to replication sites, consistent with a chromatin-related function. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit reduced body size and fertility in female mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam15 T C 3: 89,345,986 E212G probably damaging Het
Adam1b A C 5: 121,500,793 S730A probably benign Het
Akr1b10 T C 6: 34,392,129 V153A probably damaging Het
Ap1m2 T C 9: 21,305,758 Y94C probably damaging Het
Arhgef33 T C 17: 80,365,282 S320P probably damaging Het
Arsg T C 11: 109,517,282 S87P probably damaging Het
Asic3 A G 5: 24,417,192 Y458C probably damaging Het
Aspm G T 1: 139,479,507 W2044L probably damaging Het
Atp1a2 T C 1: 172,278,637 I869M possibly damaging Het
Bpifb2 C T 2: 153,889,492 L263F probably damaging Het
C1s2 T C 6: 124,628,243 probably null Het
Carf G T 1: 60,148,112 A590S probably benign Het
Cbarp G T 10: 80,131,411 D658E probably damaging Het
Cd1d2 A G 3: 86,987,554 I78V probably benign Het
Cdc42bpb A T 12: 111,323,141 M418K probably benign Het
Cdhr3 A T 12: 33,068,153 probably null Het
Cep290 A G 10: 100,518,850 K932R probably benign Het
Ces1d A C 8: 93,181,534 N310K probably benign Het
Chka A G 19: 3,885,960 K240R probably damaging Het
Cltb C T 13: 54,598,761 R64H probably damaging Het
Cyp4f37 A G 17: 32,629,087 E193G probably benign Het
Dhrs9 C A 2: 69,397,641 H200N probably benign Het
Dnah6 T A 6: 73,086,181 N2698I probably damaging Het
Dnah8 T C 17: 30,700,406 S1118P probably benign Het
Dyrk1a A G 16: 94,692,023 Y705C possibly damaging Het
Elmod1 T C 9: 53,925,972 N183S probably damaging Het
Fam129a T C 1: 151,703,766 V412A possibly damaging Het
Fer1l6 G A 15: 58,626,280 probably null Het
Fsip2 A T 2: 82,986,166 Y4081F possibly damaging Het
Gm38394 A G 1: 133,659,389 I70T probably benign Het
Gsr A G 8: 33,693,853 D381G probably benign Het
Gucy1a1 A G 3: 82,108,922 L253S possibly damaging Het
Herc3 C A 6: 58,894,113 T69K possibly damaging Het
Hoxb13 A G 11: 96,194,951 Y170C probably damaging Het
Hsd3b5 T C 3: 98,619,648 M161V probably benign Het
Lrp6 G A 6: 134,470,730 R985* probably null Het
March5 T A 19: 37,220,394 I154K probably damaging Het
Mcemp1 A G 8: 3,665,835 probably null Het
Mrpl2 G T 17: 46,649,041 C212F possibly damaging Het
Mterf1a G A 5: 3,891,119 R250W possibly damaging Het
Mthfd1 A G 12: 76,294,138 probably null Het
Mul1 T C 4: 138,436,349 F19L probably benign Het
Mycbp2 G T 14: 103,346,297 A74E probably benign Het
Myo5a A T 9: 75,201,297 probably null Het
Ncor2 A T 5: 125,055,825 S33T probably damaging Het
Ninj1 A G 13: 49,194,987 N191S probably damaging Het
Nrap T C 19: 56,342,338 probably null Het
Ofcc1 G A 13: 40,015,388 T841I probably damaging Het
Olfr353 T C 2: 36,890,190 I219M probably damaging Het
Olfr50 T A 2: 36,793,479 M81K probably damaging Het
Osbpl5 C A 7: 143,694,316 V671L probably benign Het
Paics T C 5: 76,956,603 L25S probably benign Het
Pcmtd1 A G 1: 7,120,367 E20G probably damaging Het
Pgbd5 G A 8: 124,376,227 Q228* probably null Het
Pnpla7 T C 2: 25,050,873 V1079A probably damaging Het
Pou2f1 G A 1: 165,913,261 T113I probably benign Het
Ppp1r14c A G 10: 3,463,416 I150V possibly damaging Het
Ppp1r2 A G 16: 31,260,637 Y115H possibly damaging Het
Ptchd4 T C 17: 42,502,777 V523A probably benign Het
Rabep1 G C 11: 70,917,751 S468T probably damaging Het
Rgs6 T A 12: 83,066,015 W200R probably damaging Het
Ryr3 C T 2: 112,755,174 probably null Het
Scamp2 A T 9: 57,577,194 D20V probably damaging Het
Sec24d G A 3: 123,358,870 V844M probably damaging Het
Sept10 T A 10: 59,192,329 N57Y probably damaging Het
Sis T C 3: 72,928,237 K931E possibly damaging Het
Slamf7 T C 1: 171,636,366 T258A probably benign Het
Slc15a1 A G 14: 121,487,029 S144P probably damaging Het
Slc6a7 A T 18: 61,002,181 V425E probably benign Het
Syt7 C T 19: 10,439,212 R253* probably null Het
Tm4sf1 A T 3: 57,294,785 C2S possibly damaging Het
Trio CCTTCTTCTTCT CCTTCTTCT 15: 27,772,998 probably benign Het
Trpm3 C T 19: 22,902,142 H594Y probably damaging Het
Tshz1 A T 18: 84,015,082 N400K probably damaging Het
Vat1 A T 11: 101,460,615 M300K probably benign Het
Vmn1r70 C A 7: 10,633,629 probably null Het
Vmn2r5 C T 3: 64,503,918 D410N probably damaging Het
Yap1 T C 9: 7,934,681 D428G probably damaging Het
Zfp157 A G 5: 138,456,929 Y463C probably damaging Het
Other mutations in Atad2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Atad2b APN 12 5024593 missense probably damaging 1.00
IGL00917:Atad2b APN 12 4965837 unclassified probably benign
IGL01011:Atad2b APN 12 4965984 missense probably benign 0.01
IGL01092:Atad2b APN 12 5017987 missense probably damaging 0.98
IGL01604:Atad2b APN 12 4965837 unclassified probably benign
IGL01924:Atad2b APN 12 5034093 missense probably damaging 1.00
IGL02197:Atad2b APN 12 5018056 missense possibly damaging 0.84
IGL02397:Atad2b APN 12 4974046 missense probably damaging 1.00
IGL02404:Atad2b APN 12 4941972 missense probably benign 0.08
IGL02517:Atad2b APN 12 5018037 missense probably benign 0.07
IGL02726:Atad2b APN 12 4974003 nonsense probably null
IGL02896:Atad2b APN 12 4958151 missense probably damaging 1.00
IGL03227:Atad2b APN 12 5006715 missense probably damaging 1.00
IGL03265:Atad2b APN 12 5024628 missense probably benign 0.24
Plyers UTSW 12 4973970 missense probably damaging 1.00
Smidge UTSW 12 4990949 missense probably damaging 1.00
Tensor UTSW 12 4957558 missense probably damaging 1.00
Traction UTSW 12 5027182 critical splice donor site probably null
Vice UTSW 12 5018002 missense probably damaging 1.00
K3955:Atad2b UTSW 12 4954536 splice site probably benign
P0038:Atad2b UTSW 12 4954536 splice site probably benign
PIT4418001:Atad2b UTSW 12 5024587 missense probably benign 0.07
PIT4431001:Atad2b UTSW 12 5031795 missense possibly damaging 0.77
R0006:Atad2b UTSW 12 4942030 missense possibly damaging 0.81
R0006:Atad2b UTSW 12 4942030 missense possibly damaging 0.81
R0124:Atad2b UTSW 12 4952676 missense probably benign 0.23
R0462:Atad2b UTSW 12 4941973 missense possibly damaging 0.79
R0483:Atad2b UTSW 12 4945035 splice site probably benign
R0617:Atad2b UTSW 12 4937401 missense probably benign 0.43
R0894:Atad2b UTSW 12 4965915 missense probably damaging 1.00
R0942:Atad2b UTSW 12 5024591 missense probably damaging 1.00
R0960:Atad2b UTSW 12 5006593 splice site probably benign
R0973:Atad2b UTSW 12 5031784 missense probably benign 0.00
R1306:Atad2b UTSW 12 4974239 missense probably benign 0.08
R1530:Atad2b UTSW 12 4942018 nonsense probably null
R1678:Atad2b UTSW 12 4965899 missense possibly damaging 0.91
R1689:Atad2b UTSW 12 5034575 nonsense probably null
R1826:Atad2b UTSW 12 4974094 missense probably benign 0.00
R1996:Atad2b UTSW 12 4990883 missense probably benign 0.01
R2233:Atad2b UTSW 12 5006745 missense probably damaging 1.00
R2235:Atad2b UTSW 12 5006745 missense probably damaging 1.00
R2943:Atad2b UTSW 12 4942067 missense probably damaging 0.98
R3161:Atad2b UTSW 12 4939689 missense possibly damaging 0.87
R3162:Atad2b UTSW 12 4939689 missense possibly damaging 0.87
R3162:Atad2b UTSW 12 4939689 missense possibly damaging 0.87
R3508:Atad2b UTSW 12 4950595 critical splice donor site probably null
R4239:Atad2b UTSW 12 4985710 missense probably benign 0.05
R4401:Atad2b UTSW 12 4940145 missense probably damaging 0.99
R4558:Atad2b UTSW 12 4943223 missense probably benign 0.10
R4559:Atad2b UTSW 12 4943223 missense probably benign 0.10
R4639:Atad2b UTSW 12 5018053 missense probably damaging 1.00
R4847:Atad2b UTSW 12 4944901 splice site probably null
R4850:Atad2b UTSW 12 4943251 missense probably benign 0.15
R4851:Atad2b UTSW 12 4943251 missense probably benign 0.15
R4979:Atad2b UTSW 12 5034513 missense probably damaging 1.00
R5024:Atad2b UTSW 12 4937534 missense probably benign 0.45
R5305:Atad2b UTSW 12 4965855 missense probably damaging 1.00
R5405:Atad2b UTSW 12 4940098 missense possibly damaging 0.87
R5627:Atad2b UTSW 12 4917911 missense probably benign 0.01
R5754:Atad2b UTSW 12 5010351 missense probably benign 0.01
R6163:Atad2b UTSW 12 4954593 missense probably benign 0.00
R6371:Atad2b UTSW 12 4973970 missense probably damaging 1.00
R6374:Atad2b UTSW 12 5018002 missense probably damaging 1.00
R6399:Atad2b UTSW 12 4957558 missense probably damaging 1.00
R6433:Atad2b UTSW 12 4952642 missense possibly damaging 0.89
R6546:Atad2b UTSW 12 4990949 missense probably damaging 1.00
R6617:Atad2b UTSW 12 5024668 missense probably benign 0.00
R7199:Atad2b UTSW 12 5017992 missense probably damaging 1.00
R7267:Atad2b UTSW 12 5027105 nonsense probably null
R7405:Atad2b UTSW 12 4943232 missense probably benign 0.08
R7460:Atad2b UTSW 12 4952660 missense probably benign 0.28
R7568:Atad2b UTSW 12 5010390 critical splice donor site probably null
R7593:Atad2b UTSW 12 5031726 missense probably benign 0.16
R7648:Atad2b UTSW 12 5027182 critical splice donor site probably null
R8253:Atad2b UTSW 12 4974159 missense possibly damaging 0.54
R8253:Atad2b UTSW 12 4974160 missense probably benign 0.02
R8708:Atad2b UTSW 12 4961253 missense probably damaging 1.00
R8894:Atad2b UTSW 12 5014001 critical splice donor site probably null
R8948:Atad2b UTSW 12 4991012 missense possibly damaging 0.87
R8976:Atad2b UTSW 12 4917923 critical splice donor site probably null
R9052:Atad2b UTSW 12 4965982 missense probably damaging 1.00
R9057:Atad2b UTSW 12 5018102 nonsense probably null
R9134:Atad2b UTSW 12 5010351 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCTCAGGATGGTGGCGAG -3'
(R):5'- CCCATCAAATTGTCTCCTGTGG -3'

Sequencing Primer
(F):5'- AGAGCCTTTGCCCACTGG -3'
(R):5'- GGATGAAAGGTGTGCACTACCTTATC -3'
Posted On 2015-09-24