Incidental Mutation 'R4573:Fer1l6'
ID 343460
Institutional Source Beutler Lab
Gene Symbol Fer1l6
Ensembl Gene ENSMUSG00000037106
Gene Name fer-1-like 6 (C. elegans)
Synonyms EG631797
MMRRC Submission 041598-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock # R4573 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 58510048-58665092 bp(+) (GRCm38)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 58626280 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161028] [ENSMUST00000161028]
AlphaFold E0CZ42
Predicted Effect probably null
Transcript: ENSMUST00000161028
SMART Domains Protein: ENSMUSP00000125718
Gene: ENSMUSG00000037106

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
C2 83 179 4.09e-12 SMART
FerI 165 235 2.06e-36 SMART
C2 243 354 5.19e-14 SMART
low complexity region 412 449 N/A INTRINSIC
FerB 714 787 2.53e-45 SMART
C2 829 936 8.84e-8 SMART
C2 1000 1099 3.05e0 SMART
low complexity region 1189 1203 N/A INTRINSIC
low complexity region 1256 1270 N/A INTRINSIC
C2 1361 1460 5.78e-12 SMART
low complexity region 1518 1529 N/A INTRINSIC
C2 1601 1731 1.01e-2 SMART
Pfam:Ferlin_C 1765 1857 2.3e-40 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000161028
SMART Domains Protein: ENSMUSP00000125718
Gene: ENSMUSG00000037106

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
C2 83 179 4.09e-12 SMART
FerI 165 235 2.06e-36 SMART
C2 243 354 5.19e-14 SMART
low complexity region 412 449 N/A INTRINSIC
FerB 714 787 2.53e-45 SMART
C2 829 936 8.84e-8 SMART
C2 1000 1099 3.05e0 SMART
low complexity region 1189 1203 N/A INTRINSIC
low complexity region 1256 1270 N/A INTRINSIC
C2 1361 1460 5.78e-12 SMART
low complexity region 1518 1529 N/A INTRINSIC
C2 1601 1731 1.01e-2 SMART
Pfam:Ferlin_C 1765 1857 2.3e-40 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam15 T C 3: 89,345,986 E212G probably damaging Het
Adam1b A C 5: 121,500,793 S730A probably benign Het
Akr1b10 T C 6: 34,392,129 V153A probably damaging Het
Ap1m2 T C 9: 21,305,758 Y94C probably damaging Het
Arhgef33 T C 17: 80,365,282 S320P probably damaging Het
Arsg T C 11: 109,517,282 S87P probably damaging Het
Asic3 A G 5: 24,417,192 Y458C probably damaging Het
Aspm G T 1: 139,479,507 W2044L probably damaging Het
Atad2b T C 12: 4,954,663 probably null Het
Atp1a2 T C 1: 172,278,637 I869M possibly damaging Het
Bpifb2 C T 2: 153,889,492 L263F probably damaging Het
C1s2 T C 6: 124,628,243 probably null Het
Carf G T 1: 60,148,112 A590S probably benign Het
Cbarp G T 10: 80,131,411 D658E probably damaging Het
Cd1d2 A G 3: 86,987,554 I78V probably benign Het
Cdc42bpb A T 12: 111,323,141 M418K probably benign Het
Cdhr3 A T 12: 33,068,153 probably null Het
Cep290 A G 10: 100,518,850 K932R probably benign Het
Ces1d A C 8: 93,181,534 N310K probably benign Het
Chka A G 19: 3,885,960 K240R probably damaging Het
Cltb C T 13: 54,598,761 R64H probably damaging Het
Cyp4f37 A G 17: 32,629,087 E193G probably benign Het
Dhrs9 C A 2: 69,397,641 H200N probably benign Het
Dnah6 T A 6: 73,086,181 N2698I probably damaging Het
Dnah8 T C 17: 30,700,406 S1118P probably benign Het
Dyrk1a A G 16: 94,692,023 Y705C possibly damaging Het
Elmod1 T C 9: 53,925,972 N183S probably damaging Het
Fam129a T C 1: 151,703,766 V412A possibly damaging Het
Fsip2 A T 2: 82,986,166 Y4081F possibly damaging Het
Gm38394 A G 1: 133,659,389 I70T probably benign Het
Gsr A G 8: 33,693,853 D381G probably benign Het
Gucy1a1 A G 3: 82,108,922 L253S possibly damaging Het
Herc3 C A 6: 58,894,113 T69K possibly damaging Het
Hoxb13 A G 11: 96,194,951 Y170C probably damaging Het
Hsd3b5 T C 3: 98,619,648 M161V probably benign Het
Lrp6 G A 6: 134,470,730 R985* probably null Het
March5 T A 19: 37,220,394 I154K probably damaging Het
Mcemp1 A G 8: 3,665,835 probably null Het
Mrpl2 G T 17: 46,649,041 C212F possibly damaging Het
Mterf1a G A 5: 3,891,119 R250W possibly damaging Het
Mthfd1 A G 12: 76,294,138 probably null Het
Mul1 T C 4: 138,436,349 F19L probably benign Het
Mycbp2 G T 14: 103,346,297 A74E probably benign Het
Myo5a A T 9: 75,201,297 probably null Het
Ncor2 A T 5: 125,055,825 S33T probably damaging Het
Ninj1 A G 13: 49,194,987 N191S probably damaging Het
Nrap T C 19: 56,342,338 probably null Het
Ofcc1 G A 13: 40,015,388 T841I probably damaging Het
Olfr353 T C 2: 36,890,190 I219M probably damaging Het
Olfr50 T A 2: 36,793,479 M81K probably damaging Het
Osbpl5 C A 7: 143,694,316 V671L probably benign Het
Paics T C 5: 76,956,603 L25S probably benign Het
Pcmtd1 A G 1: 7,120,367 E20G probably damaging Het
Pgbd5 G A 8: 124,376,227 Q228* probably null Het
Pnpla7 T C 2: 25,050,873 V1079A probably damaging Het
Pou2f1 G A 1: 165,913,261 T113I probably benign Het
Ppp1r14c A G 10: 3,463,416 I150V possibly damaging Het
Ppp1r2 A G 16: 31,260,637 Y115H possibly damaging Het
Ptchd4 T C 17: 42,502,777 V523A probably benign Het
Rabep1 G C 11: 70,917,751 S468T probably damaging Het
Rgs6 T A 12: 83,066,015 W200R probably damaging Het
Ryr3 C T 2: 112,755,174 probably null Het
Scamp2 A T 9: 57,577,194 D20V probably damaging Het
Sec24d G A 3: 123,358,870 V844M probably damaging Het
Sept10 T A 10: 59,192,329 N57Y probably damaging Het
Sis T C 3: 72,928,237 K931E possibly damaging Het
Slamf7 T C 1: 171,636,366 T258A probably benign Het
Slc15a1 A G 14: 121,487,029 S144P probably damaging Het
Slc6a7 A T 18: 61,002,181 V425E probably benign Het
Syt7 C T 19: 10,439,212 R253* probably null Het
Tm4sf1 A T 3: 57,294,785 C2S possibly damaging Het
Trio CCTTCTTCTTCT CCTTCTTCT 15: 27,772,998 probably benign Het
Trpm3 C T 19: 22,902,142 H594Y probably damaging Het
Tshz1 A T 18: 84,015,082 N400K probably damaging Het
Vat1 A T 11: 101,460,615 M300K probably benign Het
Vmn1r70 C A 7: 10,633,629 probably null Het
Vmn2r5 C T 3: 64,503,918 D410N probably damaging Het
Yap1 T C 9: 7,934,681 D428G probably damaging Het
Zfp157 A G 5: 138,456,929 Y463C probably damaging Het
Other mutations in Fer1l6
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0009:Fer1l6 UTSW 15 58662787 missense probably damaging 1.00
R0141:Fer1l6 UTSW 15 58558402 missense probably damaging 1.00
R0178:Fer1l6 UTSW 15 58637914 splice site probably null
R0304:Fer1l6 UTSW 15 58590562 missense probably benign 0.08
R0379:Fer1l6 UTSW 15 58548338 missense probably benign 0.05
R0457:Fer1l6 UTSW 15 58638094 critical splice donor site probably null
R0546:Fer1l6 UTSW 15 58558408 splice site probably null
R0602:Fer1l6 UTSW 15 58577945 missense probably damaging 0.98
R0619:Fer1l6 UTSW 15 58662935 splice site probably null
R0669:Fer1l6 UTSW 15 58553724 splice site probably null
R0854:Fer1l6 UTSW 15 58559188 missense probably benign 0.00
R0948:Fer1l6 UTSW 15 58564075 missense probably benign 0.00
R1180:Fer1l6 UTSW 15 58602311 splice site probably benign
R1483:Fer1l6 UTSW 15 58637970 missense possibly damaging 0.84
R1627:Fer1l6 UTSW 15 58641879 missense probably benign 0.41
R1635:Fer1l6 UTSW 15 58647081 missense probably damaging 1.00
R1834:Fer1l6 UTSW 15 58557869 missense possibly damaging 0.58
R1921:Fer1l6 UTSW 15 58625231 missense probably damaging 1.00
R2000:Fer1l6 UTSW 15 58602311 splice site probably benign
R2041:Fer1l6 UTSW 15 58558306 missense probably damaging 1.00
R2144:Fer1l6 UTSW 15 58627534 missense probably benign
R2145:Fer1l6 UTSW 15 58627534 missense probably benign
R2981:Fer1l6 UTSW 15 58564077 missense probably damaging 0.99
R4164:Fer1l6 UTSW 15 58559238 missense possibly damaging 0.83
R4192:Fer1l6 UTSW 15 58647149 missense probably damaging 1.00
R4273:Fer1l6 UTSW 15 58627522 missense probably benign 0.41
R4581:Fer1l6 UTSW 15 58640226 missense probably damaging 1.00
R4624:Fer1l6 UTSW 15 58553705 missense probably damaging 1.00
R4755:Fer1l6 UTSW 15 58640211 missense probably benign 0.09
R4774:Fer1l6 UTSW 15 58577949 missense probably damaging 0.99
R4894:Fer1l6 UTSW 15 58618902 missense probably damaging 1.00
R4896:Fer1l6 UTSW 15 58638020 missense probably damaging 1.00
R4921:Fer1l6 UTSW 15 58600311 critical splice acceptor site probably null
R4962:Fer1l6 UTSW 15 58571401 missense probably benign 0.03
R5029:Fer1l6 UTSW 15 58643920 missense probably benign 0.00
R5134:Fer1l6 UTSW 15 58640154 missense probably damaging 1.00
R5175:Fer1l6 UTSW 15 58550277 missense probably damaging 1.00
R5227:Fer1l6 UTSW 15 58581903 nonsense probably null
R5561:Fer1l6 UTSW 15 58660825 missense probably damaging 0.97
R5621:Fer1l6 UTSW 15 58558326 missense probably damaging 1.00
R5670:Fer1l6 UTSW 15 58622482 missense probably benign 0.00
R5745:Fer1l6 UTSW 15 58571389 missense probably benign 0.01
R5807:Fer1l6 UTSW 15 58590550 nonsense probably null
R5823:Fer1l6 UTSW 15 58590503 nonsense probably null
R5892:Fer1l6 UTSW 15 58564068 missense probably benign
R6006:Fer1l6 UTSW 15 58647044 missense probably damaging 1.00
R6137:Fer1l6 UTSW 15 58559206 missense probably damaging 0.97
R6195:Fer1l6 UTSW 15 58637957 missense probably damaging 1.00
R6234:Fer1l6 UTSW 15 58560639 missense probably damaging 1.00
R6237:Fer1l6 UTSW 15 58625177 nonsense probably null
R6237:Fer1l6 UTSW 15 58638006 missense probably damaging 1.00
R6271:Fer1l6 UTSW 15 58641918 missense probably benign 0.01
R6336:Fer1l6 UTSW 15 58559232 nonsense probably null
R6784:Fer1l6 UTSW 15 58571426 missense possibly damaging 0.63
R6852:Fer1l6 UTSW 15 58594878 missense probably damaging 1.00
R7030:Fer1l6 UTSW 15 58629378 missense probably damaging 1.00
R7088:Fer1l6 UTSW 15 58564050 missense possibly damaging 0.69
R7181:Fer1l6 UTSW 15 58575297 missense probably benign 0.00
R7226:Fer1l6 UTSW 15 58590535 missense probably benign 0.00
R7266:Fer1l6 UTSW 15 58627597 missense probably benign
R7463:Fer1l6 UTSW 15 58573601 nonsense probably null
R7464:Fer1l6 UTSW 15 58573247 splice site probably null
R7469:Fer1l6 UTSW 15 58590570 splice site probably null
R7483:Fer1l6 UTSW 15 58641945 missense possibly damaging 0.83
R7491:Fer1l6 UTSW 15 58600432 missense probably damaging 1.00
R7534:Fer1l6 UTSW 15 58638026 missense probably damaging 1.00
R7562:Fer1l6 UTSW 15 58560482 missense probably benign 0.00
R7580:Fer1l6 UTSW 15 58558396 missense probably benign 0.41
R7599:Fer1l6 UTSW 15 58627589 missense probably benign
R7607:Fer1l6 UTSW 15 58662732 nonsense probably null
R7677:Fer1l6 UTSW 15 58602290 missense probably benign 0.00
R8202:Fer1l6 UTSW 15 58630637 missense probably damaging 1.00
R8261:Fer1l6 UTSW 15 58560496 missense possibly damaging 0.84
R8847:Fer1l6 UTSW 15 58542163 missense possibly damaging 0.72
R9022:Fer1l6 UTSW 15 58583480 missense probably damaging 0.99
R9030:Fer1l6 UTSW 15 58630745 missense probably damaging 1.00
R9160:Fer1l6 UTSW 15 58643866 missense possibly damaging 0.94
R9180:Fer1l6 UTSW 15 58622381 missense probably benign 0.19
R9289:Fer1l6 UTSW 15 58618917 missense probably damaging 1.00
R9559:Fer1l6 UTSW 15 58557910 missense possibly damaging 0.88
R9562:Fer1l6 UTSW 15 58618521 missense possibly damaging 0.70
R9682:Fer1l6 UTSW 15 58550264 missense probably benign 0.03
R9775:Fer1l6 UTSW 15 58625249 missense probably benign
X0021:Fer1l6 UTSW 15 58569202 nonsense probably null
X0027:Fer1l6 UTSW 15 58629340 missense probably damaging 1.00
X0063:Fer1l6 UTSW 15 58618574 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGAGCCATGTCTTCACAGTG -3'
(R):5'- TCTTGTAACATGGGACTGAACC -3'

Sequencing Primer
(F):5'- AGTGAGACTTCATTCTAGAGTCTCC -3'
(R):5'- CCAAGGAATCCCAAGTAGGTC -3'
Posted On 2015-09-24