Incidental Mutation 'R0058:Sorbs2'
ID 34347
Institutional Source Beutler Lab
Gene Symbol Sorbs2
Ensembl Gene ENSMUSG00000031626
Gene Name sorbin and SH3 domain containing 2
Synonyms 2010203O03Rik, 9430041O17Rik
MMRRC Submission 038352-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0058 (G1)
Quality Score 215
Status Validated
Chromosome 8
Chromosomal Location 45960825-46280943 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) T to A at 46238291 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000128000 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067065] [ENSMUST00000067065] [ENSMUST00000067107] [ENSMUST00000125295] [ENSMUST00000125295] [ENSMUST00000130011] [ENSMUST00000132139] [ENSMUST00000132139] [ENSMUST00000135336] [ENSMUST00000138049] [ENSMUST00000171337] [ENSMUST00000211095] [ENSMUST00000153798] [ENSMUST00000139869]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000067065
SMART Domains Protein: ENSMUSP00000070720
Gene: ENSMUSG00000031626

low complexity region 48 61 N/A INTRINSIC
low complexity region 105 121 N/A INTRINSIC
low complexity region 136 154 N/A INTRINSIC
low complexity region 266 283 N/A INTRINSIC
low complexity region 362 373 N/A INTRINSIC
low complexity region 606 618 N/A INTRINSIC
low complexity region 619 630 N/A INTRINSIC
SH3 845 900 5.1e-23 SMART
low complexity region 901 916 N/A INTRINSIC
SH3 920 977 3.9e-19 SMART
SH3 1023 1079 2.48e-12 SMART
Predicted Effect probably null
Transcript: ENSMUST00000067065
SMART Domains Protein: ENSMUSP00000070720
Gene: ENSMUSG00000031626

low complexity region 48 61 N/A INTRINSIC
low complexity region 105 121 N/A INTRINSIC
low complexity region 136 154 N/A INTRINSIC
low complexity region 266 283 N/A INTRINSIC
low complexity region 362 373 N/A INTRINSIC
low complexity region 606 618 N/A INTRINSIC
low complexity region 619 630 N/A INTRINSIC
SH3 845 900 5.1e-23 SMART
low complexity region 901 916 N/A INTRINSIC
SH3 920 977 3.9e-19 SMART
SH3 1023 1079 2.48e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000067107
SMART Domains Protein: ENSMUSP00000067641
Gene: ENSMUSG00000031626

Sorb 167 217 9.63e-34 SMART
low complexity region 264 277 N/A INTRINSIC
low complexity region 382 399 N/A INTRINSIC
low complexity region 478 489 N/A INTRINSIC
low complexity region 722 734 N/A INTRINSIC
low complexity region 735 746 N/A INTRINSIC
SH3 962 1017 5.1e-23 SMART
low complexity region 1018 1033 N/A INTRINSIC
SH3 1037 1094 3.9e-19 SMART
SH3 1140 1196 2.48e-12 SMART
Predicted Effect probably null
Transcript: ENSMUST00000125295
SMART Domains Protein: ENSMUSP00000116768
Gene: ENSMUSG00000031626

Sorb 6 56 9.63e-34 SMART
low complexity region 103 116 N/A INTRINSIC
low complexity region 160 176 N/A INTRINSIC
low complexity region 191 209 N/A INTRINSIC
low complexity region 321 338 N/A INTRINSIC
low complexity region 417 428 N/A INTRINSIC
low complexity region 661 673 N/A INTRINSIC
low complexity region 674 685 N/A INTRINSIC
SH3 900 955 5.1e-23 SMART
low complexity region 956 971 N/A INTRINSIC
SH3 975 1032 3.9e-19 SMART
SH3 1078 1134 2.48e-12 SMART
Predicted Effect probably null
Transcript: ENSMUST00000125295
SMART Domains Protein: ENSMUSP00000116768
Gene: ENSMUSG00000031626

Sorb 6 56 9.63e-34 SMART
low complexity region 103 116 N/A INTRINSIC
low complexity region 160 176 N/A INTRINSIC
low complexity region 191 209 N/A INTRINSIC
low complexity region 321 338 N/A INTRINSIC
low complexity region 417 428 N/A INTRINSIC
low complexity region 661 673 N/A INTRINSIC
low complexity region 674 685 N/A INTRINSIC
SH3 900 955 5.1e-23 SMART
low complexity region 956 971 N/A INTRINSIC
SH3 975 1032 3.9e-19 SMART
SH3 1078 1134 2.48e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130011
SMART Domains Protein: ENSMUSP00000121619
Gene: ENSMUSG00000031626

Sorb 113 163 1.01e-27 SMART
low complexity region 195 208 N/A INTRINSIC
low complexity region 252 268 N/A INTRINSIC
low complexity region 283 301 N/A INTRINSIC
low complexity region 366 383 N/A INTRINSIC
SH3 418 473 5.1e-23 SMART
low complexity region 474 489 N/A INTRINSIC
SH3 493 550 3.9e-19 SMART
SH3 596 652 2.48e-12 SMART
Predicted Effect probably null
Transcript: ENSMUST00000132139
SMART Domains Protein: ENSMUSP00000123250
Gene: ENSMUSG00000031626

Sorb 144 194 9.63e-34 SMART
low complexity region 241 254 N/A INTRINSIC
low complexity region 298 314 N/A INTRINSIC
low complexity region 329 347 N/A INTRINSIC
low complexity region 431 448 N/A INTRINSIC
SH3 483 538 5.1e-23 SMART
low complexity region 539 554 N/A INTRINSIC
SH3 558 615 3.9e-19 SMART
SH3 636 707 2.16e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000132139
SMART Domains Protein: ENSMUSP00000123250
Gene: ENSMUSG00000031626

Sorb 144 194 9.63e-34 SMART
low complexity region 241 254 N/A INTRINSIC
low complexity region 298 314 N/A INTRINSIC
low complexity region 329 347 N/A INTRINSIC
low complexity region 431 448 N/A INTRINSIC
SH3 483 538 5.1e-23 SMART
low complexity region 539 554 N/A INTRINSIC
SH3 558 615 3.9e-19 SMART
SH3 636 707 2.16e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132767
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135116
Predicted Effect probably benign
Transcript: ENSMUST00000135336
SMART Domains Protein: ENSMUSP00000114286
Gene: ENSMUSG00000031626

Sorb 167 217 9.63e-34 SMART
low complexity region 264 277 N/A INTRINSIC
low complexity region 382 399 N/A INTRINSIC
low complexity region 478 489 N/A INTRINSIC
low complexity region 722 734 N/A INTRINSIC
low complexity region 735 746 N/A INTRINSIC
SH3 962 1017 5.1e-23 SMART
low complexity region 1018 1033 N/A INTRINSIC
SH3 1037 1094 3.9e-19 SMART
SH3 1140 1196 2.48e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138049
SMART Domains Protein: ENSMUSP00000123503
Gene: ENSMUSG00000031626

Sorb 167 217 1.01e-27 SMART
low complexity region 249 262 N/A INTRINSIC
low complexity region 367 384 N/A INTRINSIC
low complexity region 463 474 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000171337
SMART Domains Protein: ENSMUSP00000128000
Gene: ENSMUSG00000031626

Sorb 167 217 9.63e-34 SMART
low complexity region 264 277 N/A INTRINSIC
low complexity region 401 418 N/A INTRINSIC
low complexity region 497 508 N/A INTRINSIC
low complexity region 741 753 N/A INTRINSIC
low complexity region 754 765 N/A INTRINSIC
SH3 980 1035 5.1e-23 SMART
low complexity region 1036 1051 N/A INTRINSIC
SH3 1055 1112 3.9e-19 SMART
SH3 1158 1214 2.48e-12 SMART
Predicted Effect probably null
Transcript: ENSMUST00000140088
SMART Domains Protein: ENSMUSP00000114158
Gene: ENSMUSG00000031626

Sorb 2 25 9.17e-1 SMART
low complexity region 57 70 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000140088
SMART Domains Protein: ENSMUSP00000114158
Gene: ENSMUSG00000031626

Sorb 2 25 9.17e-1 SMART
low complexity region 57 70 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000146627
SMART Domains Protein: ENSMUSP00000120487
Gene: ENSMUSG00000031626

low complexity region 10 26 N/A INTRINSIC
low complexity region 41 59 N/A INTRINSIC
low complexity region 143 160 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000146627
SMART Domains Protein: ENSMUSP00000120487
Gene: ENSMUSG00000031626

low complexity region 10 26 N/A INTRINSIC
low complexity region 41 59 N/A INTRINSIC
low complexity region 143 160 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000211095
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211721
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209931
Predicted Effect probably benign
Transcript: ENSMUST00000153798
SMART Domains Protein: ENSMUSP00000118353
Gene: ENSMUSG00000031626

Sorb 136 186 9.63e-34 SMART
low complexity region 233 246 N/A INTRINSIC
low complexity region 351 368 N/A INTRINSIC
SH3 403 458 5.1e-23 SMART
low complexity region 459 474 N/A INTRINSIC
SH3 478 535 3.9e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000155858
SMART Domains Protein: ENSMUSP00000122820
Gene: ENSMUSG00000031626

low complexity region 50 63 N/A INTRINSIC
low complexity region 107 123 N/A INTRINSIC
low complexity region 138 156 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139869
SMART Domains Protein: ENSMUSP00000121235
Gene: ENSMUSG00000031626

Sorb 136 186 1.01e-27 SMART
low complexity region 218 231 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
SH3 389 444 5.1e-23 SMART
low complexity region 445 460 N/A INTRINSIC
SH3 464 521 3.9e-19 SMART
SH3 567 623 2.48e-12 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Arg and c-Abl represent the mammalian members of the Abelson family of non-receptor protein-tyrosine kinases. They interact with the Arg/Abl binding proteins via the SH3 domains present in the carboxy end of the latter group of proteins. This gene encodes the sorbin and SH3 domain containing 2 protein. It has three C-terminal SH3 domains and an N-terminal sorbin homology (SoHo) domain that interacts with lipid raft proteins. The subcellular localization of this protein in epithelial and cardiac muscle cells suggests that it functions as an adapter protein to assemble signaling complexes in stress fibers, and that it is a potential link between Abl family kinases and the actin cytoskeleton. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial postnatal lethality, reduced dendritic complexity, decreased excitatory synaptic transmission in dentate gyrus granule cells, a reduced acoustic startle response, and impaired long-term object recognition memory and contextual fear memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ache T G 5: 137,289,104 (GRCm39) V270G probably damaging Het
Acss1 A T 2: 150,470,459 (GRCm39) W394R probably damaging Het
Adgrv1 A G 13: 81,330,791 (GRCm39) V6088A possibly damaging Het
Ankrd36 A G 11: 5,580,691 (GRCm39) probably benign Het
Anxa1 A T 19: 20,361,141 (GRCm39) Y84N probably damaging Het
Arnt2 G A 7: 83,996,738 (GRCm39) R63C probably damaging Het
Avpr1b A G 1: 131,527,524 (GRCm39) T16A probably benign Het
Bpifb1 G A 2: 154,048,460 (GRCm39) R165H possibly damaging Het
Cables1 A G 18: 12,056,470 (GRCm39) E316G possibly damaging Het
Cadm1 A T 9: 47,761,629 (GRCm39) I427L probably damaging Het
Ccdc97 T C 7: 25,415,405 (GRCm39) D86G probably benign Het
Cgnl1 C A 9: 71,548,679 (GRCm39) D1081Y probably damaging Het
Cgnl1 T A 9: 71,632,122 (GRCm39) R410W probably damaging Het
Cntnap4 G A 8: 113,512,416 (GRCm39) E593K probably damaging Het
Dazap1 T C 10: 80,097,415 (GRCm39) probably benign Het
Dip2b A G 15: 100,113,121 (GRCm39) E1512G probably benign Het
Dock1 G A 7: 134,710,490 (GRCm39) V1171M possibly damaging Het
Dock5 A T 14: 68,018,485 (GRCm39) F1230Y probably benign Het
Dym G A 18: 75,176,243 (GRCm39) E15K possibly damaging Het
Ednra C A 8: 78,393,951 (GRCm39) probably null Het
Faf1 A G 4: 109,593,821 (GRCm39) Q133R probably benign Het
Fbxw28 A G 9: 109,157,279 (GRCm39) I323T probably benign Het
Fcer2a T C 8: 3,738,111 (GRCm39) probably benign Het
Fmo2 A T 1: 162,713,893 (GRCm39) S204R probably benign Het
Frmd4b A G 6: 97,400,460 (GRCm39) V63A probably damaging Het
Fzd8 G A 18: 9,213,985 (GRCm39) A356T possibly damaging Het
Ghitm A G 14: 36,853,549 (GRCm39) L97P probably damaging Het
Gins4 A G 8: 23,719,526 (GRCm39) probably benign Het
Golga3 T A 5: 110,350,643 (GRCm39) F766Y possibly damaging Het
Hapln1 T C 13: 89,755,997 (GRCm39) I267T probably benign Het
Helz A T 11: 107,563,384 (GRCm39) probably benign Het
Herc2 T C 7: 55,820,231 (GRCm39) V2851A possibly damaging Het
Igkv8-18 G A 6: 70,333,105 (GRCm39) probably benign Het
Igll1 A T 16: 16,681,740 (GRCm39) V5E probably benign Het
Irx3 T C 8: 92,527,168 (GRCm39) T179A possibly damaging Het
Kif16b A G 2: 142,699,225 (GRCm39) probably null Het
Limk1 A T 5: 134,688,725 (GRCm39) W507R probably damaging Het
Marf1 C T 16: 13,960,398 (GRCm39) A549T probably damaging Het
Mtif3 C A 5: 146,893,731 (GRCm39) V159F probably benign Het
Myh6 C T 14: 55,200,861 (GRCm39) R169Q probably damaging Het
Ncoa7 T A 10: 30,523,537 (GRCm39) D887V probably damaging Het
Obox7 C T 7: 14,398,313 (GRCm39) P76S probably benign Het
Or10ak12 A G 4: 118,666,677 (GRCm39) M128T probably benign Het
Or11l3 A T 11: 58,516,494 (GRCm39) I126N probably damaging Het
Pitpnm2 G A 5: 124,262,093 (GRCm39) A862V probably damaging Het
Pkd1 G C 17: 24,783,677 (GRCm39) A162P probably benign Het
Plce1 A G 19: 38,513,628 (GRCm39) D309G possibly damaging Het
Plk4 T C 3: 40,760,307 (GRCm39) V401A probably benign Het
Prdx3 T C 19: 60,862,950 (GRCm39) probably benign Het
Prrc2c C T 1: 162,526,453 (GRCm39) V253I unknown Het
Ranbp2 T A 10: 58,316,353 (GRCm39) S2358T probably damaging Het
Setd2 T A 9: 110,423,494 (GRCm39) V2183E probably damaging Het
Sgsm1 T A 5: 113,432,953 (GRCm39) S232C probably damaging Het
Skint6 A T 4: 112,904,012 (GRCm39) probably benign Het
Slc15a2 A G 16: 36,574,909 (GRCm39) I531T probably benign Het
Slc36a1 C T 11: 55,112,820 (GRCm39) probably benign Het
Sptan1 T C 2: 29,883,708 (GRCm39) probably null Het
Stam T C 2: 14,142,952 (GRCm39) C336R probably damaging Het
Stil G T 4: 114,898,495 (GRCm39) A1042S probably damaging Het
Stxbp5l T A 16: 36,962,736 (GRCm39) D773V possibly damaging Het
Sugct A T 13: 17,847,166 (GRCm39) L39Q probably damaging Het
Tep1 A G 14: 51,071,522 (GRCm39) V2041A possibly damaging Het
Tex15 C T 8: 34,071,530 (GRCm39) probably benign Het
Tlr9 T G 9: 106,102,164 (GRCm39) L485R possibly damaging Het
Tmem207 A G 16: 26,343,579 (GRCm39) probably benign Het
Triml2 T C 8: 43,638,306 (GRCm39) probably benign Het
Trip6 A G 5: 137,309,107 (GRCm39) probably benign Het
Tspear T C 10: 77,705,465 (GRCm39) F288L probably benign Het
Vmn1r179 C T 7: 23,628,592 (GRCm39) T261I possibly damaging Het
Zfp644 A T 5: 106,784,869 (GRCm39) S559R possibly damaging Het
Other mutations in Sorbs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Sorbs2 APN 8 46,252,743 (GRCm39) splice site probably null
IGL00964:Sorbs2 APN 8 46,248,714 (GRCm39) missense probably damaging 0.97
IGL01101:Sorbs2 APN 8 46,198,460 (GRCm39) missense possibly damaging 0.93
IGL01586:Sorbs2 APN 8 46,248,631 (GRCm39) missense probably damaging 1.00
IGL01611:Sorbs2 APN 8 46,248,381 (GRCm39) missense probably null
IGL01662:Sorbs2 APN 8 46,256,866 (GRCm39) splice site probably benign
IGL01970:Sorbs2 APN 8 46,198,840 (GRCm39) missense probably damaging 1.00
IGL02169:Sorbs2 APN 8 46,276,786 (GRCm39) missense probably damaging 0.98
IGL02685:Sorbs2 APN 8 46,256,877 (GRCm39) missense probably benign 0.00
IGL03036:Sorbs2 APN 8 46,235,902 (GRCm39) missense probably benign
IGL03151:Sorbs2 APN 8 46,252,750 (GRCm39) missense probably benign 0.01
IGL03164:Sorbs2 APN 8 46,235,911 (GRCm39) missense probably benign 0.01
IGL03350:Sorbs2 APN 8 46,258,844 (GRCm39) missense probably damaging 0.99
BB001:Sorbs2 UTSW 8 46,248,507 (GRCm39) missense probably damaging 1.00
BB011:Sorbs2 UTSW 8 46,248,507 (GRCm39) missense probably damaging 1.00
R0058:Sorbs2 UTSW 8 46,249,300 (GRCm39) missense probably damaging 1.00
R0233:Sorbs2 UTSW 8 46,222,866 (GRCm39) missense probably damaging 1.00
R0233:Sorbs2 UTSW 8 46,222,866 (GRCm39) missense probably damaging 1.00
R0265:Sorbs2 UTSW 8 46,238,374 (GRCm39) splice site probably benign
R0306:Sorbs2 UTSW 8 46,248,767 (GRCm39) missense probably benign 0.00
R0308:Sorbs2 UTSW 8 46,248,167 (GRCm39) nonsense probably null
R0638:Sorbs2 UTSW 8 46,249,347 (GRCm39) missense probably damaging 1.00
R0940:Sorbs2 UTSW 8 46,249,539 (GRCm39) missense probably benign 0.39
R1110:Sorbs2 UTSW 8 46,248,767 (GRCm39) missense probably benign 0.13
R1160:Sorbs2 UTSW 8 46,223,613 (GRCm39) missense probably damaging 1.00
R1226:Sorbs2 UTSW 8 46,248,656 (GRCm39) missense probably damaging 1.00
R1271:Sorbs2 UTSW 8 46,249,004 (GRCm39) missense probably damaging 1.00
R1440:Sorbs2 UTSW 8 46,243,000 (GRCm39) splice site probably benign
R1514:Sorbs2 UTSW 8 46,222,866 (GRCm39) missense probably damaging 1.00
R1557:Sorbs2 UTSW 8 46,212,234 (GRCm39) splice site probably benign
R1582:Sorbs2 UTSW 8 46,258,814 (GRCm39) missense probably damaging 0.99
R1626:Sorbs2 UTSW 8 46,222,891 (GRCm39) missense probably damaging 1.00
R1700:Sorbs2 UTSW 8 46,254,021 (GRCm39) missense probably damaging 1.00
R1759:Sorbs2 UTSW 8 46,216,056 (GRCm39) makesense probably null
R1766:Sorbs2 UTSW 8 46,223,613 (GRCm39) missense probably damaging 1.00
R1782:Sorbs2 UTSW 8 46,258,733 (GRCm39) missense probably damaging 1.00
R1932:Sorbs2 UTSW 8 46,249,389 (GRCm39) missense probably benign 0.01
R1954:Sorbs2 UTSW 8 46,198,775 (GRCm39) missense probably benign 0.23
R2060:Sorbs2 UTSW 8 46,228,666 (GRCm39) missense probably damaging 1.00
R2149:Sorbs2 UTSW 8 46,248,480 (GRCm39) missense probably damaging 0.99
R2568:Sorbs2 UTSW 8 46,248,407 (GRCm39) nonsense probably null
R3812:Sorbs2 UTSW 8 46,216,067 (GRCm39) missense probably benign 0.00
R3831:Sorbs2 UTSW 8 46,248,132 (GRCm39) missense probably damaging 1.00
R3975:Sorbs2 UTSW 8 46,225,747 (GRCm39) critical splice donor site probably null
R4033:Sorbs2 UTSW 8 46,228,632 (GRCm39) missense probably damaging 1.00
R4714:Sorbs2 UTSW 8 46,248,330 (GRCm39) missense possibly damaging 0.89
R4828:Sorbs2 UTSW 8 46,194,652 (GRCm39) intron probably benign
R4926:Sorbs2 UTSW 8 46,249,254 (GRCm39) missense probably benign 0.03
R5027:Sorbs2 UTSW 8 46,199,571 (GRCm39) splice site probably null
R5118:Sorbs2 UTSW 8 46,248,822 (GRCm39) missense probably damaging 1.00
R5159:Sorbs2 UTSW 8 46,248,767 (GRCm39) missense probably benign 0.00
R5342:Sorbs2 UTSW 8 46,249,050 (GRCm39) missense probably damaging 0.96
R5390:Sorbs2 UTSW 8 46,272,778 (GRCm39) missense probably damaging 1.00
R5436:Sorbs2 UTSW 8 46,249,038 (GRCm39) missense probably damaging 1.00
R5655:Sorbs2 UTSW 8 46,194,618 (GRCm39) critical splice donor site probably null
R5687:Sorbs2 UTSW 8 46,228,669 (GRCm39) missense probably damaging 1.00
R5695:Sorbs2 UTSW 8 46,245,912 (GRCm39) missense probably benign 0.27
R5733:Sorbs2 UTSW 8 46,212,226 (GRCm39) missense probably damaging 1.00
R5928:Sorbs2 UTSW 8 46,216,220 (GRCm39) missense probably damaging 1.00
R5949:Sorbs2 UTSW 8 46,222,934 (GRCm39) critical splice donor site probably null
R6341:Sorbs2 UTSW 8 46,223,615 (GRCm39) missense probably damaging 1.00
R6620:Sorbs2 UTSW 8 46,249,213 (GRCm39) missense probably damaging 1.00
R6761:Sorbs2 UTSW 8 46,225,651 (GRCm39) missense probably damaging 1.00
R7349:Sorbs2 UTSW 8 46,248,860 (GRCm39) nonsense probably null
R7404:Sorbs2 UTSW 8 46,212,233 (GRCm39) splice site probably null
R7524:Sorbs2 UTSW 8 46,248,693 (GRCm39) missense probably benign 0.00
R7809:Sorbs2 UTSW 8 46,198,465 (GRCm39) missense possibly damaging 0.93
R7820:Sorbs2 UTSW 8 46,249,593 (GRCm39) missense probably null 0.16
R7924:Sorbs2 UTSW 8 46,248,507 (GRCm39) missense probably damaging 1.00
R8285:Sorbs2 UTSW 8 46,249,104 (GRCm39) missense probably damaging 0.98
R8696:Sorbs2 UTSW 8 46,248,686 (GRCm39) missense possibly damaging 0.95
R8927:Sorbs2 UTSW 8 46,248,952 (GRCm39) missense probably damaging 1.00
R8928:Sorbs2 UTSW 8 46,248,952 (GRCm39) missense probably damaging 1.00
R9005:Sorbs2 UTSW 8 46,248,774 (GRCm39) missense probably benign
R9006:Sorbs2 UTSW 8 46,258,858 (GRCm39) missense possibly damaging 0.95
R9016:Sorbs2 UTSW 8 46,248,774 (GRCm39) missense probably benign
R9017:Sorbs2 UTSW 8 46,248,774 (GRCm39) missense probably benign
R9091:Sorbs2 UTSW 8 46,248,774 (GRCm39) missense probably benign
R9196:Sorbs2 UTSW 8 46,258,864 (GRCm39) missense probably benign 0.12
R9256:Sorbs2 UTSW 8 46,248,774 (GRCm39) missense probably benign
R9282:Sorbs2 UTSW 8 46,248,774 (GRCm39) missense probably benign
R9283:Sorbs2 UTSW 8 46,248,774 (GRCm39) missense probably benign
R9384:Sorbs2 UTSW 8 46,258,864 (GRCm39) missense probably benign 0.12
R9624:Sorbs2 UTSW 8 46,228,690 (GRCm39) missense possibly damaging 0.89
R9664:Sorbs2 UTSW 8 46,276,788 (GRCm39) missense probably benign 0.05
Z1176:Sorbs2 UTSW 8 46,243,062 (GRCm39) missense probably null 0.96
Z1177:Sorbs2 UTSW 8 46,235,996 (GRCm39) missense probably benign
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- tgaatactttaacctaatgagccatc -3'
Posted On 2013-05-09