Mutagenetix > Incidental Mutation

Incidental Mutation 'R0058:Sorbs2'

34347

Institutional Source

Beutler Lab

Gene Symbol

Sorbs2

Ensembl Gene

ENSMUSG00000031626

Gene Name

sorbin and SH3 domain containing 2

Synonyms

MMRRC Submission

038352-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0058 (G1)

Quality Score

215

Status

Validated

Chromosome

Chromosomal Location

45507788-45827906 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to A at 45785254 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000128000 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000067065] [ENSMUST00000067065] [ENSMUST00000067107] [ENSMUST00000125295] [ENSMUST00000125295] [ENSMUST00000130011] [ENSMUST00000132139] [ENSMUST00000132139] [ENSMUST00000135336] [ENSMUST00000138049] [ENSMUST00000139869] [ENSMUST00000171337] [ENSMUST00000211095] [ENSMUST00000153798]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000067065

SMART Domains

Protein: ENSMUSP00000070720
Gene: ENSMUSG00000031626

Domain	Start	End	E-Value	Type
low complexity region	48	61	N/A	INTRINSIC
low complexity region	105	121	N/A	INTRINSIC
low complexity region	136	154	N/A	INTRINSIC
low complexity region	266	283	N/A	INTRINSIC
low complexity region	362	373	N/A	INTRINSIC
low complexity region	606	618	N/A	INTRINSIC
low complexity region	619	630	N/A	INTRINSIC
SH3	845	900	5.1e-23	SMART
low complexity region	901	916	N/A	INTRINSIC
SH3	920	977	3.9e-19	SMART
SH3	1023	1079	2.48e-12	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000067065

SMART Domains

Protein: ENSMUSP00000070720
Gene: ENSMUSG00000031626

Domain	Start	End	E-Value	Type
low complexity region	48	61	N/A	INTRINSIC
low complexity region	105	121	N/A	INTRINSIC
low complexity region	136	154	N/A	INTRINSIC
low complexity region	266	283	N/A	INTRINSIC
low complexity region	362	373	N/A	INTRINSIC
low complexity region	606	618	N/A	INTRINSIC
low complexity region	619	630	N/A	INTRINSIC
SH3	845	900	5.1e-23	SMART
low complexity region	901	916	N/A	INTRINSIC
SH3	920	977	3.9e-19	SMART
SH3	1023	1079	2.48e-12	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000067107

SMART Domains

Protein: ENSMUSP00000067641
Gene: ENSMUSG00000031626

Domain	Start	End	E-Value	Type
Sorb	167	217	9.63e-34	SMART
low complexity region	264	277	N/A	INTRINSIC
low complexity region	382	399	N/A	INTRINSIC
low complexity region	478	489	N/A	INTRINSIC
low complexity region	722	734	N/A	INTRINSIC
low complexity region	735	746	N/A	INTRINSIC
SH3	962	1017	5.1e-23	SMART
low complexity region	1018	1033	N/A	INTRINSIC
SH3	1037	1094	3.9e-19	SMART
SH3	1140	1196	2.48e-12	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000125295

SMART Domains

Protein: ENSMUSP00000116768
Gene: ENSMUSG00000031626

Domain	Start	End	E-Value	Type
Sorb	6	56	9.63e-34	SMART
low complexity region	103	116	N/A	INTRINSIC
low complexity region	160	176	N/A	INTRINSIC
low complexity region	191	209	N/A	INTRINSIC
low complexity region	321	338	N/A	INTRINSIC
low complexity region	417	428	N/A	INTRINSIC
low complexity region	661	673	N/A	INTRINSIC
low complexity region	674	685	N/A	INTRINSIC
SH3	900	955	5.1e-23	SMART
low complexity region	956	971	N/A	INTRINSIC
SH3	975	1032	3.9e-19	SMART
SH3	1078	1134	2.48e-12	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000125295

SMART Domains

Protein: ENSMUSP00000116768
Gene: ENSMUSG00000031626

Domain	Start	End	E-Value	Type
Sorb	6	56	9.63e-34	SMART
low complexity region	103	116	N/A	INTRINSIC
low complexity region	160	176	N/A	INTRINSIC
low complexity region	191	209	N/A	INTRINSIC
low complexity region	321	338	N/A	INTRINSIC
low complexity region	417	428	N/A	INTRINSIC
low complexity region	661	673	N/A	INTRINSIC
low complexity region	674	685	N/A	INTRINSIC
SH3	900	955	5.1e-23	SMART
low complexity region	956	971	N/A	INTRINSIC
SH3	975	1032	3.9e-19	SMART
SH3	1078	1134	2.48e-12	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000130011

SMART Domains

Protein: ENSMUSP00000121619
Gene: ENSMUSG00000031626

Domain	Start	End	E-Value	Type
Sorb	113	163	1.01e-27	SMART
low complexity region	195	208	N/A	INTRINSIC
low complexity region	252	268	N/A	INTRINSIC
low complexity region	283	301	N/A	INTRINSIC
low complexity region	366	383	N/A	INTRINSIC
SH3	418	473	5.1e-23	SMART
low complexity region	474	489	N/A	INTRINSIC
SH3	493	550	3.9e-19	SMART
SH3	596	652	2.48e-12	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000132139

SMART Domains

Protein: ENSMUSP00000123250
Gene: ENSMUSG00000031626

Domain	Start	End	E-Value	Type
Sorb	144	194	9.63e-34	SMART
low complexity region	241	254	N/A	INTRINSIC
low complexity region	298	314	N/A	INTRINSIC
low complexity region	329	347	N/A	INTRINSIC
low complexity region	431	448	N/A	INTRINSIC
SH3	483	538	5.1e-23	SMART
low complexity region	539	554	N/A	INTRINSIC
SH3	558	615	3.9e-19	SMART
SH3	636	707	2.16e-3	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000132139

SMART Domains

Protein: ENSMUSP00000123250
Gene: ENSMUSG00000031626

Domain	Start	End	E-Value	Type
Sorb	144	194	9.63e-34	SMART
low complexity region	241	254	N/A	INTRINSIC
low complexity region	298	314	N/A	INTRINSIC
low complexity region	329	347	N/A	INTRINSIC
low complexity region	431	448	N/A	INTRINSIC
SH3	483	538	5.1e-23	SMART
low complexity region	539	554	N/A	INTRINSIC
SH3	558	615	3.9e-19	SMART
SH3	636	707	2.16e-3	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132767

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135116

Predicted Effect

probably benign
Transcript: ENSMUST00000135336

SMART Domains

Protein: ENSMUSP00000114286
Gene: ENSMUSG00000031626

Domain	Start	End	E-Value	Type
Sorb	167	217	9.63e-34	SMART
low complexity region	264	277	N/A	INTRINSIC
low complexity region	382	399	N/A	INTRINSIC
low complexity region	478	489	N/A	INTRINSIC
low complexity region	722	734	N/A	INTRINSIC
low complexity region	735	746	N/A	INTRINSIC
SH3	962	1017	5.1e-23	SMART
low complexity region	1018	1033	N/A	INTRINSIC
SH3	1037	1094	3.9e-19	SMART
SH3	1140	1196	2.48e-12	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000138049

SMART Domains

Protein: ENSMUSP00000123503
Gene: ENSMUSG00000031626

Domain	Start	End	E-Value	Type
Sorb	167	217	1.01e-27	SMART
low complexity region	249	262	N/A	INTRINSIC
low complexity region	367	384	N/A	INTRINSIC
low complexity region	463	474	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000139869

SMART Domains

Protein: ENSMUSP00000121235
Gene: ENSMUSG00000031626

Domain	Start	End	E-Value	Type
Sorb	136	186	1.01e-27	SMART
low complexity region	218	231	N/A	INTRINSIC
low complexity region	336	353	N/A	INTRINSIC
SH3	389	444	5.1e-23	SMART
low complexity region	445	460	N/A	INTRINSIC
SH3	464	521	3.9e-19	SMART
SH3	567	623	2.48e-12	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000140088

SMART Domains

Protein: ENSMUSP00000114158
Gene: ENSMUSG00000031626

Domain	Start	End	E-Value	Type
Sorb	2	25	9.17e-1	SMART
low complexity region	57	70	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000140088

SMART Domains

Protein: ENSMUSP00000114158
Gene: ENSMUSG00000031626

Domain	Start	End	E-Value	Type
Sorb	2	25	9.17e-1	SMART
low complexity region	57	70	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000146627

SMART Domains

Protein: ENSMUSP00000120487
Gene: ENSMUSG00000031626

Domain	Start	End	E-Value	Type
low complexity region	10	26	N/A	INTRINSIC
low complexity region	41	59	N/A	INTRINSIC
low complexity region	143	160	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000146627

SMART Domains

Protein: ENSMUSP00000120487
Gene: ENSMUSG00000031626

Domain	Start	End	E-Value	Type
low complexity region	10	26	N/A	INTRINSIC
low complexity region	41	59	N/A	INTRINSIC
low complexity region	143	160	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000171337

SMART Domains

Protein: ENSMUSP00000128000
Gene: ENSMUSG00000031626

Domain	Start	End	E-Value	Type
Sorb	167	217	9.63e-34	SMART
low complexity region	264	277	N/A	INTRINSIC
low complexity region	401	418	N/A	INTRINSIC
low complexity region	497	508	N/A	INTRINSIC
low complexity region	741	753	N/A	INTRINSIC
low complexity region	754	765	N/A	INTRINSIC
SH3	980	1035	5.1e-23	SMART
low complexity region	1036	1051	N/A	INTRINSIC
SH3	1055	1112	3.9e-19	SMART
SH3	1158	1214	2.48e-12	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000211095

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211721

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000209931

Predicted Effect

probably benign
Transcript: ENSMUST00000153798

SMART Domains

Protein: ENSMUSP00000118353
Gene: ENSMUSG00000031626

Domain	Start	End	E-Value	Type
Sorb	136	186	9.63e-34	SMART
low complexity region	233	246	N/A	INTRINSIC
low complexity region	351	368	N/A	INTRINSIC
SH3	403	458	5.1e-23	SMART
low complexity region	459	474	N/A	INTRINSIC
SH3	478	535	3.9e-19	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000155858

SMART Domains

Protein: ENSMUSP00000122820
Gene: ENSMUSG00000031626

Domain	Start	End	E-Value	Type
low complexity region	50	63	N/A	INTRINSIC
low complexity region	107	123	N/A	INTRINSIC
low complexity region	138	156	N/A	INTRINSIC

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.0%
20x: 94.8%

Validation Efficiency

100% (74/74)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Arg and c-Abl represent the mammalian members of the Abelson family of non-receptor protein-tyrosine kinases. They interact with the Arg/Abl binding proteins via the SH3 domains present in the carboxy end of the latter group of proteins. This gene encodes the sorbin and SH3 domain containing 2 protein. It has three C-terminal SH3 domains and an N-terminal sorbin homology (SoHo) domain that interacts with lipid raft proteins. The subcellular localization of this protein in epithelial and cardiac muscle cells suggests that it functions as an adapter protein to assemble signaling complexes in stress fibers, and that it is a potential link between Abl family kinases and the actin cytoskeleton. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial postnatal lethality, reduced dendritic complexity, decreased excitatory synaptic transmission in dentate gyrus granule cells, a reduced acoustic startle response, and impaired long-term object recognition memory and contextual fear memory. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ache	T	G	5: 137,290,842	V270G	probably damaging	Het
Acss1	A	T	2: 150,628,539	W394R	probably damaging	Het
Adgrv1	A	G	13: 81,182,672	V6088A	possibly damaging	Het
Ankrd36	A	G	11: 5,630,691		probably benign	Het
Anxa1	A	T	19: 20,383,777	Y84N	probably damaging	Het
Arnt2	G	A	7: 84,347,530	R63C	probably damaging	Het
Avpr1b	A	G	1: 131,599,786	T16A	probably benign	Het
Bpifb1	G	A	2: 154,206,540	R165H	possibly damaging	Het
Cables1	A	G	18: 11,923,413	E316G	possibly damaging	Het
Cadm1	A	T	9: 47,850,331	I427L	probably damaging	Het
Ccdc97	T	C	7: 25,715,980	D86G	probably benign	Het
Cgnl1	C	A	9: 71,641,397	D1081Y	probably damaging	Het
Cgnl1	T	A	9: 71,724,840	R410W	probably damaging	Het
Cntnap4	G	A	8: 112,785,784	E593K	probably damaging	Het
Dazap1	T	C	10: 80,261,581		probably benign	Het
Dip2b	A	G	15: 100,215,240	E1512G	probably benign	Het
Dock1	G	A	7: 135,108,761	V1171M	possibly damaging	Het
Dock5	A	T	14: 67,781,036	F1230Y	probably benign	Het
Dym	G	A	18: 75,043,172	E15K	possibly damaging	Het
Ednra	C	A	8: 77,667,322		probably null	Het
Faf1	A	G	4: 109,736,624	Q133R	probably benign	Het
Fbxw28	A	G	9: 109,328,211	I323T	probably benign	Het
Fcer2a	T	C	8: 3,688,111		probably benign	Het
Fmo2	A	T	1: 162,886,324	S204R	probably benign	Het
Frmd4b	A	G	6: 97,423,499	V63A	probably damaging	Het
Fzd8	G	A	18: 9,213,985	A356T	possibly damaging	Het
Ghitm	A	G	14: 37,131,592	L97P	probably damaging	Het
Gins4	A	G	8: 23,229,510		probably benign	Het
Golga3	T	A	5: 110,202,777	F766Y	possibly damaging	Het
Hapln1	T	C	13: 89,607,878	I267T	probably benign	Het
Helz	A	T	11: 107,672,558		probably benign	Het
Herc2	T	C	7: 56,170,483	V2851A	possibly damaging	Het
Igkv8-18	G	A	6: 70,356,121		probably benign	Het
Igll1	A	T	16: 16,863,876	V5E	probably benign	Het
Irx3	T	C	8: 91,800,540	T179A	possibly damaging	Het
Kif16b	A	G	2: 142,857,305		probably null	Het
Limk1	A	T	5: 134,659,871	W507R	probably damaging	Het
Marf1	C	T	16: 14,142,534	A549T	probably damaging	Het
Mtif3	C	A	5: 146,956,921	V159F	probably benign	Het
Myh6	C	T	14: 54,963,404	R169Q	probably damaging	Het
Ncoa7	T	A	10: 30,647,541	D887V	probably damaging	Het
Obox7	C	T	7: 14,664,388	P76S	probably benign	Het
Olfr1335	A	G	4: 118,809,480	M128T	probably benign	Het
Olfr323	A	T	11: 58,625,668	I126N	probably damaging	Het
Pitpnm2	G	A	5: 124,124,030	A862V	probably damaging	Het
Pkd1	G	C	17: 24,564,703	A162P	probably benign	Het
Plce1	A	G	19: 38,525,184	D309G	possibly damaging	Het
Plk4	T	C	3: 40,805,872	V401A	probably benign	Het
Prdx3	T	C	19: 60,874,512		probably benign	Het
Prrc2c	C	T	1: 162,698,884	V253I	unknown	Het
Ranbp2	T	A	10: 58,480,531	S2358T	probably damaging	Het
Setd2	T	A	9: 110,594,426	V2183E	probably damaging	Het
Sgsm1	T	A	5: 113,285,087	S232C	probably damaging	Het
Skint6	A	T	4: 113,046,815		probably benign	Het
Slc15a2	A	G	16: 36,754,547	I531T	probably benign	Het
Slc36a1	C	T	11: 55,221,994		probably benign	Het
Sptan1	T	C	2: 29,993,696		probably null	Het
Stam	T	C	2: 14,138,141	C336R	probably damaging	Het
Stil	G	T	4: 115,041,298	A1042S	probably damaging	Het
Stxbp5l	T	A	16: 37,142,374	D773V	possibly damaging	Het
Sugct	A	T	13: 17,672,581	L39Q	probably damaging	Het
Tep1	A	G	14: 50,834,065	V2041A	possibly damaging	Het
Tex15	C	T	8: 33,581,502		probably benign	Het
Tlr9	T	G	9: 106,224,965	L485R	possibly damaging	Het
Tmem207	A	G	16: 26,524,829		probably benign	Het
Triml2	T	C	8: 43,185,269		probably benign	Het
Trip6	A	G	5: 137,310,845		probably benign	Het
Tspear	T	C	10: 77,869,631	F288L	probably benign	Het
Vmn1r179	C	T	7: 23,929,167	T261I	possibly damaging	Het
Zfp644	A	T	5: 106,637,003	S559R	possibly damaging	Het

Other mutations in Sorbs2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00423:Sorbs2	APN	8	45799706	splice site	probably null
IGL00964:Sorbs2	APN	8	45795677	missense	probably damaging	0.97
IGL01101:Sorbs2	APN	8	45745423	missense	possibly damaging	0.93
IGL01586:Sorbs2	APN	8	45795594	missense	probably damaging	1.00
IGL01611:Sorbs2	APN	8	45795344	missense	probably null
IGL01662:Sorbs2	APN	8	45803829	splice site	probably benign
IGL01970:Sorbs2	APN	8	45745803	missense	probably damaging	1.00
IGL02169:Sorbs2	APN	8	45823749	missense	probably damaging	0.98
IGL02685:Sorbs2	APN	8	45803840	missense	probably benign	0.00
IGL03036:Sorbs2	APN	8	45782865	missense	probably benign
IGL03151:Sorbs2	APN	8	45799713	missense	probably benign	0.01
IGL03164:Sorbs2	APN	8	45782874	missense	probably benign	0.01
IGL03350:Sorbs2	APN	8	45805807	missense	probably damaging	0.99
BB001:Sorbs2	UTSW	8	45795470	missense	probably damaging	1.00
BB011:Sorbs2	UTSW	8	45795470	missense	probably damaging	1.00
R0058:Sorbs2	UTSW	8	45796263	missense	probably damaging	1.00
R0233:Sorbs2	UTSW	8	45769829	missense	probably damaging	1.00
R0233:Sorbs2	UTSW	8	45769829	missense	probably damaging	1.00
R0265:Sorbs2	UTSW	8	45785337	splice site	probably benign
R0306:Sorbs2	UTSW	8	45795730	missense	probably benign	0.00
R0308:Sorbs2	UTSW	8	45795130	nonsense	probably null
R0638:Sorbs2	UTSW	8	45796310	missense	probably damaging	1.00
R0940:Sorbs2	UTSW	8	45796502	missense	probably benign	0.39
R1110:Sorbs2	UTSW	8	45795730	missense	probably benign	0.13
R1160:Sorbs2	UTSW	8	45770576	missense	probably damaging	1.00
R1226:Sorbs2	UTSW	8	45795619	missense	probably damaging	1.00
R1271:Sorbs2	UTSW	8	45795967	missense	probably damaging	1.00
R1440:Sorbs2	UTSW	8	45789963	splice site	probably benign
R1514:Sorbs2	UTSW	8	45769829	missense	probably damaging	1.00
R1557:Sorbs2	UTSW	8	45759197	splice site	probably benign
R1582:Sorbs2	UTSW	8	45805777	missense	probably damaging	0.99
R1626:Sorbs2	UTSW	8	45769854	missense	probably damaging	1.00
R1700:Sorbs2	UTSW	8	45800984	missense	probably damaging	1.00
R1759:Sorbs2	UTSW	8	45763019	makesense	probably null
R1766:Sorbs2	UTSW	8	45770576	missense	probably damaging	1.00
R1782:Sorbs2	UTSW	8	45805696	missense	probably damaging	1.00
R1932:Sorbs2	UTSW	8	45796352	missense	probably benign	0.01
R1954:Sorbs2	UTSW	8	45745738	missense	probably benign	0.23
R2060:Sorbs2	UTSW	8	45775629	missense	probably damaging	1.00
R2149:Sorbs2	UTSW	8	45795443	missense	probably damaging	0.99
R2568:Sorbs2	UTSW	8	45795370	nonsense	probably null
R3812:Sorbs2	UTSW	8	45763030	missense	probably benign	0.00
R3831:Sorbs2	UTSW	8	45795095	missense	probably damaging	1.00
R3975:Sorbs2	UTSW	8	45772710	critical splice donor site	probably null
R4033:Sorbs2	UTSW	8	45775595	missense	probably damaging	1.00
R4714:Sorbs2	UTSW	8	45795293	missense	possibly damaging	0.89
R4828:Sorbs2	UTSW	8	45741615	intron	probably benign
R4926:Sorbs2	UTSW	8	45796217	missense	probably benign	0.03
R5027:Sorbs2	UTSW	8	45746534	splice site	probably null
R5118:Sorbs2	UTSW	8	45795785	missense	probably damaging	1.00
R5159:Sorbs2	UTSW	8	45795730	missense	probably benign	0.00
R5342:Sorbs2	UTSW	8	45796013	missense	probably damaging	0.96
R5390:Sorbs2	UTSW	8	45819741	missense	probably damaging	1.00
R5436:Sorbs2	UTSW	8	45796001	missense	probably damaging	1.00
R5655:Sorbs2	UTSW	8	45741581	critical splice donor site	probably null
R5687:Sorbs2	UTSW	8	45775632	missense	probably damaging	1.00
R5695:Sorbs2	UTSW	8	45792875	missense	probably benign	0.27
R5733:Sorbs2	UTSW	8	45759189	missense	probably damaging	1.00
R5928:Sorbs2	UTSW	8	45763183	missense	probably damaging	1.00
R5949:Sorbs2	UTSW	8	45769897	critical splice donor site	probably null
R6341:Sorbs2	UTSW	8	45770578	missense	probably damaging	1.00
R6620:Sorbs2	UTSW	8	45796176	missense	probably damaging	1.00
R6761:Sorbs2	UTSW	8	45772614	missense	probably damaging	1.00
R7349:Sorbs2	UTSW	8	45795823	nonsense	probably null
R7404:Sorbs2	UTSW	8	45759196	splice site	probably null
R7524:Sorbs2	UTSW	8	45795656	missense	probably benign	0.00
R7809:Sorbs2	UTSW	8	45745428	missense	possibly damaging	0.93
R7820:Sorbs2	UTSW	8	45796556	missense	probably null	0.16
R7924:Sorbs2	UTSW	8	45795470	missense	probably damaging	1.00
R8285:Sorbs2	UTSW	8	45796067	missense	probably damaging	0.98
R8696:Sorbs2	UTSW	8	45795649	missense	possibly damaging	0.95
R8927:Sorbs2	UTSW	8	45795915	missense	probably damaging	1.00
R8928:Sorbs2	UTSW	8	45795915	missense	probably damaging	1.00
R9005:Sorbs2	UTSW	8	45795737	missense	probably benign
R9006:Sorbs2	UTSW	8	45805821	missense	possibly damaging	0.95
R9016:Sorbs2	UTSW	8	45795737	missense	probably benign
R9017:Sorbs2	UTSW	8	45795737	missense	probably benign
R9091:Sorbs2	UTSW	8	45795737	missense	probably benign
R9196:Sorbs2	UTSW	8	45805827	missense	probably benign	0.12
R9256:Sorbs2	UTSW	8	45795737	missense	probably benign
R9282:Sorbs2	UTSW	8	45795737	missense	probably benign
R9283:Sorbs2	UTSW	8	45795737	missense	probably benign
R9384:Sorbs2	UTSW	8	45805827	missense	probably benign	0.12
R9624:Sorbs2	UTSW	8	45775653	missense	possibly damaging	0.89
R9664:Sorbs2	UTSW	8	45823751	missense	probably benign	0.05
Z1176:Sorbs2	UTSW	8	45790025	missense	probably null	0.96
Z1177:Sorbs2	UTSW	8	45782959	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CCAAAGACTGGGAGTGGTGATTTCG -3'
(R):5'- ATGCTTTTCATCCACAGTGGGTAGG -3'

Sequencing Primer
(F):5'- CGCTGTGCTTGAGAATATTTACCAG -3'
(R):5'- tgaatactttaacctaatgagccatc -3'

Posted On

2013-05-09