Mutagenetix > Incidental Mutation

Incidental Mutation 'R4579:Olfr1216'

343471

Institutional Source

Beutler Lab

Gene Symbol

Olfr1216

Ensembl Gene

ENSMUSG00000075107

Gene Name

olfactory receptor 1216

Synonyms

GA_x6K02T2Q125-50494588-50493653, MOR233-9

MMRRC Submission

041801-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.052) question?

Stock #

R4579 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

89007563-89018340 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 89013144 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 307 (I307V)

Ref Sequence

ENSEMBL: ENSMUSP00000149441 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099800] [ENSMUST00000216000] [ENSMUST00000217000]

AlphaFold

Q7TR05

Predicted Effect

probably benign
Transcript: ENSMUST00000099800
AA Change: I307V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000097388
Gene: ENSMUSG00000075107
AA Change: I307V

Domain	Start	End	E-Value	Type
Pfam:7tm_4	29	303	1.8e-46	PFAM
Pfam:7tm_1	39	286	4.2e-17	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000216000
AA Change: I307V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000217000
AA Change: I307V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218738

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

97% (88/91)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A930004D18Rik	A	G	2: 18,027,037	I90T	probably damaging	Het
Acox3	A	G	5: 35,604,643	N444D	probably damaging	Het
Adamts16	A	G	13: 70,779,624	Y499H	probably damaging	Het
Ank2	A	T	3: 126,958,963	V368D	probably damaging	Het
Atad5	T	C	11: 80,095,191	V368A	probably damaging	Het
Atp13a5	T	C	16: 29,248,338		probably null	Het
Bdh1	A	T	16: 31,436,136		probably benign	Het
Bmp6	A	T	13: 38,469,725	Y256F	probably damaging	Het
Bub1b	C	A	2: 118,623,176	S496*	probably null	Het
Capn15	C	T	17: 25,959,837	R1128H	probably damaging	Het
Ccnf	T	A	17: 24,231,329	R461*	probably null	Het
Col6a1	C	T	10: 76,711,357	V725I	unknown	Het
Cp	T	C	3: 19,957,435		probably null	Het
Cul2	T	C	18: 3,430,957	V577A	probably benign	Het
Cux2	A	T	5: 121,860,653	I1408K	probably benign	Het
Cyp2c69	T	A	19: 39,881,186	T130S	possibly damaging	Het
Cyp3a57	A	G	5: 145,374,264	T278A	probably benign	Het
Dchs1	T	G	7: 105,754,765	T2857P	probably damaging	Het
Dchs1	A	G	7: 105,758,973	M1884T	probably benign	Het
Dnah3	T	C	7: 120,009,331	S1802G	probably damaging	Het
Dner	T	C	1: 84,383,816	S691G	probably damaging	Het
Dzip1l	A	T	9: 99,647,214	Q332L	probably damaging	Het
Eprs	A	G	1: 185,401,607	Y827C	probably damaging	Het
Ermp1	A	T	19: 29,616,651	N706K	probably damaging	Het
F830045P16Rik	A	G	2: 129,463,503	L317S	probably damaging	Het
Fam120c	G	T	X: 151,436,183	G696W	probably damaging	Het
Fance	T	A	17: 28,317,151		probably null	Het
Fancl	G	T	11: 26,468,423		probably null	Het
Fbxo30	T	A	10: 11,289,549	V5E	probably benign	Het
Foxn4	A	T	5: 114,256,825	I347N	possibly damaging	Het
Galr2	A	T	11: 116,281,499	D5V	probably benign	Het
Gm14139	T	A	2: 150,192,223	Y186N	probably damaging	Het
Gm4845	T	G	1: 141,257,127		noncoding transcript	Het
Gm8909	C	T	17: 36,161,757		probably benign	Het
Gm996	T	A	2: 25,579,649	R83S	possibly damaging	Het
Gnao1	A	T	8: 93,966,904	Q73L	probably damaging	Het
Gnpat	T	A	8: 124,878,502		probably null	Het
Hectd1	A	G	12: 51,744,573	M2594T	probably damaging	Het
Hint3	T	C	10: 30,610,432	H117R	probably damaging	Het
Hsd3b6	A	G	3: 98,806,225	F253L	probably damaging	Het
Itgal	A	G	7: 127,305,294	D313G	possibly damaging	Het
Kbtbd2	A	T	6: 56,778,908	D614E	probably damaging	Het
Ksr2	A	T	5: 117,756,270	I825F	probably damaging	Het
L3mbtl4	A	T	17: 68,764,640	S521C	probably benign	Het
Lamc1	T	C	1: 153,247,269	N725S	probably damaging	Het
Med1	T	G	11: 98,158,422	E516A	possibly damaging	Het
Mical3	A	T	6: 120,958,699	V1622E	probably benign	Het
Miip	G	A	4: 147,861,061	P373S	probably damaging	Het
Myo7a	C	A	7: 98,073,193	S1175I	probably damaging	Het
Ndst3	A	T	3: 123,546,825	D781E	probably benign	Het
Nf1	T	A	11: 79,468,757	V1407E	probably damaging	Het
Olfr1066	T	C	2: 86,455,515	Y252C	probably damaging	Het
Olfr133	G	C	17: 38,149,405	K272N	probably damaging	Het
Olfr282	A	T	15: 98,437,679	D70V	probably damaging	Het
Olfr452	A	T	6: 42,790,524	I162F	probably benign	Het
Olfr870	G	T	9: 20,171,114	S152R	probably damaging	Het
Opalin	A	G	19: 41,067,757	L33P	probably damaging	Het
Pcdhb2	T	A	18: 37,296,115	N23K	probably damaging	Het
Pdap1	A	G	5: 145,136,881		probably benign	Het
Pds5b	A	G	5: 150,746,732	E395G	probably damaging	Het
Pex1	C	A	5: 3,618,880	R624S	probably benign	Het
Pitrm1	G	A	13: 6,558,225	V329I	probably benign	Het
Pop1	G	A	15: 34,515,824		probably benign	Het
Prkaa1	A	G	15: 5,160,601		probably null	Het
Slc38a6	G	T	12: 73,288,524		probably null	Het
Slc5a9	T	A	4: 111,893,187	Y158F	probably damaging	Het
Spata3	T	A	1: 86,026,453	V114E	probably damaging	Het
Tbcb	T	A	7: 30,231,594	I34F	possibly damaging	Het
Tek	T	A	4: 94,863,666	Y1014*	probably null	Het
Togaram1	G	T	12: 64,967,907	C644F	probably damaging	Het
Trim56	A	C	5: 137,114,064	D199E	possibly damaging	Het
Tssk3	A	T	4: 129,489,317	D187E	probably benign	Het
Ttn	G	A	2: 76,896,803		probably benign	Het
Twf2	G	A	9: 106,212,826	R126Q	probably benign	Het
Ugt1a10	T	C	1: 88,056,116	M212T	probably benign	Het
Vmn1r177	A	T	7: 23,866,347	F35I	possibly damaging	Het
Vmn1r44	T	A	6: 89,893,933	H77Q	possibly damaging	Het
Zfp524	G	A	7: 5,018,348	V292I	probably benign	Het
Zfp788	T	G	7: 41,647,594	I56S	probably benign	Het

Other mutations in Olfr1216

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00341:Olfr1216	APN	2	89013924	missense	probably benign	0.22
IGL00895:Olfr1216	APN	2	89013609	missense	probably benign	0.13
IGL01634:Olfr1216	APN	2	89013444	missense	probably damaging	0.99
IGL01844:Olfr1216	APN	2	89013470	missense	possibly damaging	0.95
IGL02036:Olfr1216	APN	2	89013479	missense	probably benign	0.00
IGL02102:Olfr1216	APN	2	89013126	utr 3 prime	probably benign
IGL02194:Olfr1216	APN	2	89013887	missense	probably damaging	1.00
IGL02483:Olfr1216	APN	2	89013203	missense	probably damaging	1.00
IGL02745:Olfr1216	APN	2	89013888	missense	probably damaging	1.00
IGL02829:Olfr1216	APN	2	89013677	missense	probably damaging	1.00
IGL03113:Olfr1216	APN	2	89014035	missense	probably damaging	1.00
IGL03324:Olfr1216	APN	2	89013559	nonsense	probably null
R0102:Olfr1216	UTSW	2	89013671	missense	probably damaging	1.00
R0304:Olfr1216	UTSW	2	89013288	missense	probably damaging	1.00
R1184:Olfr1216	UTSW	2	89013713	missense	probably damaging	0.99
R1484:Olfr1216	UTSW	2	89013369	nonsense	probably null
R1560:Olfr1216	UTSW	2	89013206	missense	probably damaging	1.00
R1823:Olfr1216	UTSW	2	89013378	missense	probably benign	0.02
R1911:Olfr1216	UTSW	2	89013221	missense	probably damaging	1.00
R2245:Olfr1216	UTSW	2	89013149	missense	probably benign
R2331:Olfr1216	UTSW	2	89013921	missense	probably benign
R3859:Olfr1216	UTSW	2	89014061	start codon destroyed	probably null	1.00
R5022:Olfr1216	UTSW	2	89014043	missense	probably damaging	0.96
R5353:Olfr1216	UTSW	2	89013755	missense	probably benign	0.00
R5894:Olfr1216	UTSW	2	89014055	missense	probably damaging	1.00
R6240:Olfr1216	UTSW	2	89013626	missense	probably benign	0.03
R7101:Olfr1216	UTSW	2	89013980	missense	possibly damaging	0.90
R7652:Olfr1216	UTSW	2	89013549	missense	probably benign	0.01
R8243:Olfr1216	UTSW	2	89013707	missense	probably benign	0.39
R8752:Olfr1216	UTSW	2	89013887	missense	probably damaging	1.00
R9062:Olfr1216	UTSW	2	89013204	missense	probably damaging	1.00
R9472:Olfr1216	UTSW	2	89013173	missense	possibly damaging	0.81

Predicted Primers

PCR Primer
(F):5'- TTGTGAGCATTTGTAGCCTCTC -3'
(R):5'- GGAGCCCACGTTACTGTTGTAG -3'

Sequencing Primer
(F):5'- GCGGCACTTCATTAAAATTTGAACTC -3'
(R):5'- AGCCCACGTTACTGTTGTAGTTTTG -3'

Posted On

2015-09-24