Incidental Mutation 'R4579:Bub1b'
ID343472
Institutional Source Beutler Lab
Gene Symbol Bub1b
Ensembl Gene ENSMUSG00000040084
Gene NameBUB1B, mitotic checkpoint serine/threonine kinase
SynonymsBUBR1
MMRRC Submission 041801-MU
Accession Numbers

NM_009773; MGI: 1333889

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4579 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location118598211-118641591 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 118623176 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 496 (S496*)
Ref Sequence ENSEMBL: ENSMUSP00000037126 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038341]
Predicted Effect probably null
Transcript: ENSMUST00000038341
AA Change: S496*
SMART Domains Protein: ENSMUSP00000037126
Gene: ENSMUSG00000040084
AA Change: S496*

DomainStartEndE-ValueType
PDB:4GGD|D 14 35 6e-6 PDB
Mad3_BUB1_I 49 173 1.83e-68 SMART
low complexity region 198 214 N/A INTRINSIC
low complexity region 382 395 N/A INTRINSIC
coiled coil region 418 457 N/A INTRINSIC
low complexity region 671 686 N/A INTRINSIC
low complexity region 717 726 N/A INTRINSIC
Pfam:Pkinase 806 942 4.5e-7 PFAM
Meta Mutation Damage Score 0.6436 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 97% (88/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a kinase involved in spindle checkpoint function. The protein has been localized to the kinetochore and plays a role in the inhibition of the anaphase-promoting complex/cyclosome (APC/C), delaying the onset of anaphase and ensuring proper chromosome segregation. Impaired spindle checkpoint function has been found in many forms of cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant embryos undergo extensive apoptosis and die during early gestation. Heterozygous mice are viable and exhibit splenomegaly, abnormal megakaryopoiesis, and an increased susceptibility to intestinal tumorigenesis. Hypomorphic homozygotes display infertility and premature aging. [provided by MGI curators]
Allele List at MGI

All alleles(22) : Targeted, knock-out(1) Targeted, other(3) Gene trapped(18)

Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930004D18Rik A G 2: 18,027,037 I90T probably damaging Het
Acox3 A G 5: 35,604,643 N444D probably damaging Het
Adamts16 A G 13: 70,779,624 Y499H probably damaging Het
Ank2 A T 3: 126,958,963 V368D probably damaging Het
Atad5 T C 11: 80,095,191 V368A probably damaging Het
Atp13a5 T C 16: 29,248,338 probably null Het
Bdh1 A T 16: 31,436,136 probably benign Het
Bmp6 A T 13: 38,469,725 Y256F probably damaging Het
Capn15 C T 17: 25,959,837 R1128H probably damaging Het
Ccnf T A 17: 24,231,329 R461* probably null Het
Col6a1 C T 10: 76,711,357 V725I unknown Het
Cp T C 3: 19,957,435 probably null Het
Cul2 T C 18: 3,430,957 V577A probably benign Het
Cux2 A T 5: 121,860,653 I1408K probably benign Het
Cyp2c69 T A 19: 39,881,186 T130S possibly damaging Het
Cyp3a57 A G 5: 145,374,264 T278A probably benign Het
Dchs1 T G 7: 105,754,765 T2857P probably damaging Het
Dchs1 A G 7: 105,758,973 M1884T probably benign Het
Dnah3 T C 7: 120,009,331 S1802G probably damaging Het
Dner T C 1: 84,383,816 S691G probably damaging Het
Dzip1l A T 9: 99,647,214 Q332L probably damaging Het
Eprs A G 1: 185,401,607 Y827C probably damaging Het
Ermp1 A T 19: 29,616,651 N706K probably damaging Het
F830045P16Rik A G 2: 129,463,503 L317S probably damaging Het
Fam120c G T X: 151,436,183 G696W probably damaging Het
Fance T A 17: 28,317,151 probably null Het
Fancl G T 11: 26,468,423 probably null Het
Fbxo30 T A 10: 11,289,549 V5E probably benign Het
Foxn4 A T 5: 114,256,825 I347N possibly damaging Het
Galr2 A T 11: 116,281,499 D5V probably benign Het
Gm14139 T A 2: 150,192,223 Y186N probably damaging Het
Gm4845 T G 1: 141,257,127 noncoding transcript Het
Gm8909 C T 17: 36,161,757 probably benign Het
Gm996 T A 2: 25,579,649 R83S possibly damaging Het
Gnao1 A T 8: 93,966,904 Q73L probably damaging Het
Gnpat T A 8: 124,878,502 probably null Het
Hectd1 A G 12: 51,744,573 M2594T probably damaging Het
Hint3 T C 10: 30,610,432 H117R probably damaging Het
Hsd3b6 A G 3: 98,806,225 F253L probably damaging Het
Itgal A G 7: 127,305,294 D313G possibly damaging Het
Kbtbd2 A T 6: 56,778,908 D614E probably damaging Het
Ksr2 A T 5: 117,756,270 I825F probably damaging Het
L3mbtl4 A T 17: 68,764,640 S521C probably benign Het
Lamc1 T C 1: 153,247,269 N725S probably damaging Het
Med1 T G 11: 98,158,422 E516A possibly damaging Het
Mical3 A T 6: 120,958,699 V1622E probably benign Het
Miip G A 4: 147,861,061 P373S probably damaging Het
Myo7a C A 7: 98,073,193 S1175I probably damaging Het
Ndst3 A T 3: 123,546,825 D781E probably benign Het
Nf1 T A 11: 79,468,757 V1407E probably damaging Het
Olfr1066 T C 2: 86,455,515 Y252C probably damaging Het
Olfr1216 T C 2: 89,013,144 I307V probably benign Het
Olfr133 G C 17: 38,149,405 K272N probably damaging Het
Olfr282 A T 15: 98,437,679 D70V probably damaging Het
Olfr452 A T 6: 42,790,524 I162F probably benign Het
Olfr870 G T 9: 20,171,114 S152R probably damaging Het
Opalin A G 19: 41,067,757 L33P probably damaging Het
Pcdhb2 T A 18: 37,296,115 N23K probably damaging Het
Pdap1 A G 5: 145,136,881 probably benign Het
Pds5b A G 5: 150,746,732 E395G probably damaging Het
Pex1 C A 5: 3,618,880 R624S probably benign Het
Pitrm1 G A 13: 6,558,225 V329I probably benign Het
Pop1 G A 15: 34,515,824 probably benign Het
Prkaa1 A G 15: 5,160,601 probably null Het
Slc38a6 G T 12: 73,288,524 probably null Het
Slc5a9 T A 4: 111,893,187 Y158F probably damaging Het
Spata3 T A 1: 86,026,453 V114E probably damaging Het
Tbcb T A 7: 30,231,594 I34F possibly damaging Het
Tek T A 4: 94,863,666 Y1014* probably null Het
Togaram1 G T 12: 64,967,907 C644F probably damaging Het
Trim56 A C 5: 137,114,064 D199E possibly damaging Het
Tssk3 A T 4: 129,489,317 D187E probably benign Het
Ttn G A 2: 76,896,803 probably benign Het
Twf2 G A 9: 106,212,826 R126Q probably benign Het
Ugt1a10 T C 1: 88,056,116 M212T probably benign Het
Vmn1r177 A T 7: 23,866,347 F35I possibly damaging Het
Vmn1r44 T A 6: 89,893,933 H77Q possibly damaging Het
Zfp524 G A 7: 5,018,348 V292I probably benign Het
Zfp788 T G 7: 41,647,594 I56S probably benign Het
Other mutations in Bub1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00676:Bub1b APN 2 118630138 missense probably benign
IGL01319:Bub1b APN 2 118614994 missense possibly damaging 0.49
IGL01744:Bub1b APN 2 118636749 missense probably damaging 0.99
IGL03184:Bub1b APN 2 118609777 splice site probably benign
P0035:Bub1b UTSW 2 118622185 missense probably damaging 1.00
R0315:Bub1b UTSW 2 118626976 splice site probably benign
R0322:Bub1b UTSW 2 118639618 splice site probably benign
R0378:Bub1b UTSW 2 118641123 missense probably benign 0.01
R0457:Bub1b UTSW 2 118609859 missense probably damaging 1.00
R0845:Bub1b UTSW 2 118609976 missense probably damaging 1.00
R0960:Bub1b UTSW 2 118606680 missense probably benign 0.03
R1071:Bub1b UTSW 2 118632447 frame shift probably null
R1129:Bub1b UTSW 2 118615006 missense probably damaging 1.00
R1138:Bub1b UTSW 2 118623089 missense probably benign 0.01
R1171:Bub1b UTSW 2 118606686 missense probably benign 0.31
R1613:Bub1b UTSW 2 118639741 critical splice donor site probably null
R1667:Bub1b UTSW 2 118641189 missense probably benign 0.00
R1812:Bub1b UTSW 2 118632421 missense probably benign 0.00
R1828:Bub1b UTSW 2 118638439 missense probably benign 0.00
R2085:Bub1b UTSW 2 118622195 missense possibly damaging 0.88
R2137:Bub1b UTSW 2 118636718 nonsense probably null
R3749:Bub1b UTSW 2 118615455 missense possibly damaging 0.63
R3750:Bub1b UTSW 2 118615455 missense possibly damaging 0.63
R4211:Bub1b UTSW 2 118630978 missense possibly damaging 0.78
R4993:Bub1b UTSW 2 118636770 missense possibly damaging 0.63
R5144:Bub1b UTSW 2 118615499 missense possibly damaging 0.92
R5229:Bub1b UTSW 2 118629989 missense probably damaging 1.00
R5596:Bub1b UTSW 2 118630982 missense probably damaging 1.00
R5656:Bub1b UTSW 2 118605431 missense probably damaging 1.00
R5785:Bub1b UTSW 2 118609844 missense probably damaging 0.98
R5883:Bub1b UTSW 2 118609882 missense probably damaging 1.00
R6128:Bub1b UTSW 2 118617812 missense probably benign
R6187:Bub1b UTSW 2 118631000 missense probably damaging 1.00
R6333:Bub1b UTSW 2 118598463 critical splice donor site probably null
R6985:Bub1b UTSW 2 118606614 missense probably damaging 1.00
R6988:Bub1b UTSW 2 118636830 missense probably damaging 0.96
R7161:Bub1b UTSW 2 118626053 missense probably damaging 1.00
R7341:Bub1b UTSW 2 118636786 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- ACAACAGTACCGAGGTGACG -3'
(R):5'- AAGGCAGCAGCATACATTCC -3'

Sequencing Primer
(F):5'- GATAGGTGATGCTTCCGTACACTAC -3'
(R):5'- GCATACATTCCCTCTTAGCATGGAAC -3'
Posted On2015-09-24