Incidental Mutation 'R4579:Cux2'
ID343489
Institutional Source Beutler Lab
Gene Symbol Cux2
Ensembl Gene ENSMUSG00000042589
Gene Namecut-like homeobox 2
SynonymsCutl2, Cux-2, ENSMUSG00000072641, 1700051K22Rik, Cux2
MMRRC Submission 041801-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.405) question?
Stock #R4579 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location121856366-122050102 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 121860653 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 1408 (I1408K)
Ref Sequence ENSEMBL: ENSMUSP00000130302 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086317] [ENSMUST00000111752] [ENSMUST00000168288]
Predicted Effect probably benign
Transcript: ENSMUST00000086317
AA Change: I1408K

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000083497
Gene: ENSMUSG00000042589
AA Change: I1408K

DomainStartEndE-ValueType
coiled coil region 133 214 N/A INTRINSIC
coiled coil region 235 311 N/A INTRINSIC
low complexity region 373 394 N/A INTRINSIC
low complexity region 397 408 N/A INTRINSIC
low complexity region 459 474 N/A INTRINSIC
CUT 484 569 7.62e-34 SMART
coiled coil region 626 655 N/A INTRINSIC
low complexity region 688 696 N/A INTRINSIC
low complexity region 740 757 N/A INTRINSIC
CUT 829 917 6.52e-42 SMART
low complexity region 965 976 N/A INTRINSIC
CUT 984 1070 1.12e-40 SMART
HOX 1113 1175 7.54e-13 SMART
low complexity region 1318 1332 N/A INTRINSIC
low complexity region 1351 1370 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111752
AA Change: I1408K

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000107381
Gene: ENSMUSG00000042589
AA Change: I1408K

DomainStartEndE-ValueType
coiled coil region 133 214 N/A INTRINSIC
coiled coil region 235 311 N/A INTRINSIC
low complexity region 373 394 N/A INTRINSIC
low complexity region 397 408 N/A INTRINSIC
low complexity region 459 474 N/A INTRINSIC
CUT 484 569 7.62e-34 SMART
coiled coil region 626 655 N/A INTRINSIC
low complexity region 688 696 N/A INTRINSIC
low complexity region 740 757 N/A INTRINSIC
CUT 829 917 6.52e-42 SMART
low complexity region 965 976 N/A INTRINSIC
CUT 984 1070 1.12e-40 SMART
HOX 1113 1175 7.54e-13 SMART
low complexity region 1318 1332 N/A INTRINSIC
low complexity region 1351 1370 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168288
AA Change: I1408K

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000130302
Gene: ENSMUSG00000042589
AA Change: I1408K

DomainStartEndE-ValueType
coiled coil region 133 214 N/A INTRINSIC
coiled coil region 235 311 N/A INTRINSIC
low complexity region 373 394 N/A INTRINSIC
low complexity region 397 408 N/A INTRINSIC
low complexity region 459 474 N/A INTRINSIC
CUT 484 569 7.62e-34 SMART
coiled coil region 626 655 N/A INTRINSIC
low complexity region 688 696 N/A INTRINSIC
low complexity region 740 757 N/A INTRINSIC
CUT 829 917 6.52e-42 SMART
low complexity region 965 976 N/A INTRINSIC
CUT 984 1070 1.12e-40 SMART
HOX 1113 1175 7.54e-13 SMART
low complexity region 1318 1332 N/A INTRINSIC
low complexity region 1351 1370 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197179
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 97% (88/91)
MGI Phenotype FUNCTION: This gene is a member of the Cut family of transcription factors that have multiple DNA binding domains and regulate cell proliferation and differentiation. This gene is primarily expressed in nervous tissues where it controls the proliferation of neuronal precursors, and may play a role in organogenesis earlier during embryonic development. Mice lacking the encoded protein exhibit smaller spinal cords with deficits in neural progenitor development as well as in neuroblast and interneuron differentiation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit various neural defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930004D18Rik A G 2: 18,027,037 I90T probably damaging Het
Acox3 A G 5: 35,604,643 N444D probably damaging Het
Adamts16 A G 13: 70,779,624 Y499H probably damaging Het
Ank2 A T 3: 126,958,963 V368D probably damaging Het
Atad5 T C 11: 80,095,191 V368A probably damaging Het
Atp13a5 T C 16: 29,248,338 probably null Het
Bdh1 A T 16: 31,436,136 probably benign Het
Bmp6 A T 13: 38,469,725 Y256F probably damaging Het
Bub1b C A 2: 118,623,176 S496* probably null Het
Capn15 C T 17: 25,959,837 R1128H probably damaging Het
Ccnf T A 17: 24,231,329 R461* probably null Het
Col6a1 C T 10: 76,711,357 V725I unknown Het
Cp T C 3: 19,957,435 probably null Het
Cul2 T C 18: 3,430,957 V577A probably benign Het
Cyp2c69 T A 19: 39,881,186 T130S possibly damaging Het
Cyp3a57 A G 5: 145,374,264 T278A probably benign Het
Dchs1 T G 7: 105,754,765 T2857P probably damaging Het
Dchs1 A G 7: 105,758,973 M1884T probably benign Het
Dnah3 T C 7: 120,009,331 S1802G probably damaging Het
Dner T C 1: 84,383,816 S691G probably damaging Het
Dzip1l A T 9: 99,647,214 Q332L probably damaging Het
Eprs A G 1: 185,401,607 Y827C probably damaging Het
Ermp1 A T 19: 29,616,651 N706K probably damaging Het
F830045P16Rik A G 2: 129,463,503 L317S probably damaging Het
Fam120c G T X: 151,436,183 G696W probably damaging Het
Fance T A 17: 28,317,151 probably null Het
Fancl G T 11: 26,468,423 probably null Het
Fbxo30 T A 10: 11,289,549 V5E probably benign Het
Foxn4 A T 5: 114,256,825 I347N possibly damaging Het
Galr2 A T 11: 116,281,499 D5V probably benign Het
Gm14139 T A 2: 150,192,223 Y186N probably damaging Het
Gm4845 T G 1: 141,257,127 noncoding transcript Het
Gm8909 C T 17: 36,161,757 probably benign Het
Gm996 T A 2: 25,579,649 R83S possibly damaging Het
Gnao1 A T 8: 93,966,904 Q73L probably damaging Het
Gnpat T A 8: 124,878,502 probably null Het
Hectd1 A G 12: 51,744,573 M2594T probably damaging Het
Hint3 T C 10: 30,610,432 H117R probably damaging Het
Hsd3b6 A G 3: 98,806,225 F253L probably damaging Het
Itgal A G 7: 127,305,294 D313G possibly damaging Het
Kbtbd2 A T 6: 56,778,908 D614E probably damaging Het
Ksr2 A T 5: 117,756,270 I825F probably damaging Het
L3mbtl4 A T 17: 68,764,640 S521C probably benign Het
Lamc1 T C 1: 153,247,269 N725S probably damaging Het
Med1 T G 11: 98,158,422 E516A possibly damaging Het
Mical3 A T 6: 120,958,699 V1622E probably benign Het
Miip G A 4: 147,861,061 P373S probably damaging Het
Myo7a C A 7: 98,073,193 S1175I probably damaging Het
Ndst3 A T 3: 123,546,825 D781E probably benign Het
Nf1 T A 11: 79,468,757 V1407E probably damaging Het
Olfr1066 T C 2: 86,455,515 Y252C probably damaging Het
Olfr1216 T C 2: 89,013,144 I307V probably benign Het
Olfr133 G C 17: 38,149,405 K272N probably damaging Het
Olfr282 A T 15: 98,437,679 D70V probably damaging Het
Olfr452 A T 6: 42,790,524 I162F probably benign Het
Olfr870 G T 9: 20,171,114 S152R probably damaging Het
Opalin A G 19: 41,067,757 L33P probably damaging Het
Pcdhb2 T A 18: 37,296,115 N23K probably damaging Het
Pdap1 A G 5: 145,136,881 probably benign Het
Pds5b A G 5: 150,746,732 E395G probably damaging Het
Pex1 C A 5: 3,618,880 R624S probably benign Het
Pitrm1 G A 13: 6,558,225 V329I probably benign Het
Pop1 G A 15: 34,515,824 probably benign Het
Prkaa1 A G 15: 5,160,601 probably null Het
Slc38a6 G T 12: 73,288,524 probably null Het
Slc5a9 T A 4: 111,893,187 Y158F probably damaging Het
Spata3 T A 1: 86,026,453 V114E probably damaging Het
Tbcb T A 7: 30,231,594 I34F possibly damaging Het
Tek T A 4: 94,863,666 Y1014* probably null Het
Togaram1 G T 12: 64,967,907 C644F probably damaging Het
Trim56 A C 5: 137,114,064 D199E possibly damaging Het
Tssk3 A T 4: 129,489,317 D187E probably benign Het
Ttn G A 2: 76,896,803 probably benign Het
Twf2 G A 9: 106,212,826 R126Q probably benign Het
Ugt1a10 T C 1: 88,056,116 M212T probably benign Het
Vmn1r177 A T 7: 23,866,347 F35I possibly damaging Het
Vmn1r44 T A 6: 89,893,933 H77Q possibly damaging Het
Zfp524 G A 7: 5,018,348 V292I probably benign Het
Zfp788 T G 7: 41,647,594 I56S probably benign Het
Other mutations in Cux2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Cux2 APN 5 121868538 missense possibly damaging 0.92
IGL00917:Cux2 APN 5 121869105 missense probably null 0.05
IGL00979:Cux2 APN 5 121873714 missense probably damaging 0.98
IGL01069:Cux2 APN 5 121867351 missense possibly damaging 0.84
IGL01303:Cux2 APN 5 121865928 missense probably benign 0.03
IGL01583:Cux2 APN 5 121874107 missense probably damaging 0.98
IGL01762:Cux2 APN 5 121873145 missense probably damaging 1.00
IGL02508:Cux2 APN 5 121860822 missense possibly damaging 0.93
R0333:Cux2 UTSW 5 121860608 missense probably benign 0.04
R0352:Cux2 UTSW 5 121884739 splice site probably benign
R0443:Cux2 UTSW 5 121887437 missense possibly damaging 0.66
R1853:Cux2 UTSW 5 121869121 missense possibly damaging 0.95
R2011:Cux2 UTSW 5 121861326 missense probably benign 0.21
R2057:Cux2 UTSW 5 121869504 missense probably benign 0.02
R2165:Cux2 UTSW 5 121887477 missense possibly damaging 0.78
R3964:Cux2 UTSW 5 121887476 nonsense probably null
R4182:Cux2 UTSW 5 121868492 missense probably damaging 1.00
R4655:Cux2 UTSW 5 121885934 missense possibly damaging 0.95
R4673:Cux2 UTSW 5 121887476 nonsense probably null
R4697:Cux2 UTSW 5 121873753 missense probably damaging 1.00
R4927:Cux2 UTSW 5 121877089 missense probably benign 0.13
R5348:Cux2 UTSW 5 121865978 missense probably damaging 0.99
R6208:Cux2 UTSW 5 121860822 missense possibly damaging 0.93
R6500:Cux2 UTSW 5 121864726 missense probably benign 0.03
R6661:Cux2 UTSW 5 121869297 missense probably benign 0.04
R6986:Cux2 UTSW 5 121868579 missense possibly damaging 0.84
R7296:Cux2 UTSW 5 121861256 missense probably benign 0.25
R7561:Cux2 UTSW 5 121879868 missense probably benign 0.31
R7702:Cux2 UTSW 5 121868585 missense possibly damaging 0.70
R7705:Cux2 UTSW 5 121869673 missense probably benign 0.13
R7791:Cux2 UTSW 5 121867099 missense probably benign 0.10
R7998:Cux2 UTSW 5 121868585 missense possibly damaging 0.70
X0027:Cux2 UTSW 5 121884751 missense probably benign 0.13
Z1176:Cux2 UTSW 5 121873813 nonsense probably null
Z1176:Cux2 UTSW 5 121885934 missense probably benign 0.02
Z1177:Cux2 UTSW 5 121873680 missense probably damaging 1.00
Z1177:Cux2 UTSW 5 121877129 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- ACATCTGCATGGCTGAGTTC -3'
(R):5'- TTCAAGTCCACCTCCGAATC -3'

Sequencing Primer
(F):5'- GCATGGCTGAGTTCTTGCCTC -3'
(R):5'- GAATCCTCCTGCTGCAGC -3'
Posted On2015-09-24