Incidental Mutation 'R4579:Col6a1'
ID343518
Institutional Source Beutler Lab
Gene Symbol Col6a1
Ensembl Gene ENSMUSG00000001119
Gene Namecollagen, type VI, alpha 1
SynonymsCol6a-1
MMRRC Submission 041801-MU
Accession Numbers

Ncbi RefSeq: NM_009933.4; MGI: 88459

Is this an essential gene? Probably non essential (E-score: 0.216) question?
Stock #R4579 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location76708792-76726168 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 76711357 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 725 (V725I)
Ref Sequence ENSEMBL: ENSMUSP00000001147 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001147]
Predicted Effect unknown
Transcript: ENSMUST00000001147
AA Change: V725I
SMART Domains Protein: ENSMUSP00000001147
Gene: ENSMUSG00000001119
AA Change: V725I

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
VWA 34 232 9.55e-29 SMART
Pfam:Collagen 252 312 5.6e-11 PFAM
Pfam:Collagen 292 367 2e-9 PFAM
Pfam:Collagen 345 423 3.6e-8 PFAM
Pfam:Collagen 448 515 1.1e-8 PFAM
Pfam:Collagen 499 563 1.9e-9 PFAM
low complexity region 571 590 N/A INTRINSIC
VWA 612 798 8.57e-31 SMART
VWA 824 1005 2.6e-30 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137599
Meta Mutation Damage Score 0.2937 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 97% (88/91)
MGI Phenotype Strain: 2153356
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The collagens are a superfamily of proteins that play a role in maintaining the integrity of various tissues. Collagens are extracellular matrix proteins and have a triple-helical domain as their common structural element. Collagen VI is a major structural component of microfibrils. The basic structural unit of collagen VI is a heterotrimer of the alpha1(VI), alpha2(VI), and alpha3(VI) chains. The alpha2(VI) and alpha3(VI) chains are encoded by the COL6A2 and COL6A3 genes, respectively. The protein encoded by this gene is the alpha 1 subunit of type VI collagen (alpha1(VI) chain). Mutations in the genes that code for the collagen VI subunits result in the autosomal dominant disorder, Bethlem myopathy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for this targeted mutation display a myopathic disorder that resembles human Bethlem myopathy. Loss of contractile strength in affected muscles is associated with an unexpected latent mitochondrial dysfunction in myofibers, as well as spontaneous apoptosis. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted(5)

Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930004D18Rik A G 2: 18,027,037 I90T probably damaging Het
Acox3 A G 5: 35,604,643 N444D probably damaging Het
Adamts16 A G 13: 70,779,624 Y499H probably damaging Het
Ank2 A T 3: 126,958,963 V368D probably damaging Het
Atad5 T C 11: 80,095,191 V368A probably damaging Het
Atp13a5 T C 16: 29,248,338 probably null Het
Bdh1 A T 16: 31,436,136 probably benign Het
Bmp6 A T 13: 38,469,725 Y256F probably damaging Het
Bub1b C A 2: 118,623,176 S496* probably null Het
Capn15 C T 17: 25,959,837 R1128H probably damaging Het
Ccnf T A 17: 24,231,329 R461* probably null Het
Cp T C 3: 19,957,435 probably null Het
Cul2 T C 18: 3,430,957 V577A probably benign Het
Cux2 A T 5: 121,860,653 I1408K probably benign Het
Cyp2c69 T A 19: 39,881,186 T130S possibly damaging Het
Cyp3a57 A G 5: 145,374,264 T278A probably benign Het
Dchs1 T G 7: 105,754,765 T2857P probably damaging Het
Dchs1 A G 7: 105,758,973 M1884T probably benign Het
Dnah3 T C 7: 120,009,331 S1802G probably damaging Het
Dner T C 1: 84,383,816 S691G probably damaging Het
Dzip1l A T 9: 99,647,214 Q332L probably damaging Het
Eprs A G 1: 185,401,607 Y827C probably damaging Het
Ermp1 A T 19: 29,616,651 N706K probably damaging Het
F830045P16Rik A G 2: 129,463,503 L317S probably damaging Het
Fam120c G T X: 151,436,183 G696W probably damaging Het
Fance T A 17: 28,317,151 probably null Het
Fancl G T 11: 26,468,423 probably null Het
Fbxo30 T A 10: 11,289,549 V5E probably benign Het
Foxn4 A T 5: 114,256,825 I347N possibly damaging Het
Galr2 A T 11: 116,281,499 D5V probably benign Het
Gm14139 T A 2: 150,192,223 Y186N probably damaging Het
Gm4845 T G 1: 141,257,127 noncoding transcript Het
Gm8909 C T 17: 36,161,757 probably benign Het
Gm996 T A 2: 25,579,649 R83S possibly damaging Het
Gnao1 A T 8: 93,966,904 Q73L probably damaging Het
Gnpat T A 8: 124,878,502 probably null Het
Hectd1 A G 12: 51,744,573 M2594T probably damaging Het
Hint3 T C 10: 30,610,432 H117R probably damaging Het
Hsd3b6 A G 3: 98,806,225 F253L probably damaging Het
Itgal A G 7: 127,305,294 D313G possibly damaging Het
Kbtbd2 A T 6: 56,778,908 D614E probably damaging Het
Ksr2 A T 5: 117,756,270 I825F probably damaging Het
L3mbtl4 A T 17: 68,764,640 S521C probably benign Het
Lamc1 T C 1: 153,247,269 N725S probably damaging Het
Med1 T G 11: 98,158,422 E516A possibly damaging Het
Mical3 A T 6: 120,958,699 V1622E probably benign Het
Miip G A 4: 147,861,061 P373S probably damaging Het
Myo7a C A 7: 98,073,193 S1175I probably damaging Het
Ndst3 A T 3: 123,546,825 D781E probably benign Het
Nf1 T A 11: 79,468,757 V1407E probably damaging Het
Olfr1066 T C 2: 86,455,515 Y252C probably damaging Het
Olfr1216 T C 2: 89,013,144 I307V probably benign Het
Olfr133 G C 17: 38,149,405 K272N probably damaging Het
Olfr282 A T 15: 98,437,679 D70V probably damaging Het
Olfr452 A T 6: 42,790,524 I162F probably benign Het
Olfr870 G T 9: 20,171,114 S152R probably damaging Het
Opalin A G 19: 41,067,757 L33P probably damaging Het
Pcdhb2 T A 18: 37,296,115 N23K probably damaging Het
Pdap1 A G 5: 145,136,881 probably benign Het
Pds5b A G 5: 150,746,732 E395G probably damaging Het
Pex1 C A 5: 3,618,880 R624S probably benign Het
Pitrm1 G A 13: 6,558,225 V329I probably benign Het
Pop1 G A 15: 34,515,824 probably benign Het
Prkaa1 A G 15: 5,160,601 probably null Het
Slc38a6 G T 12: 73,288,524 probably null Het
Slc5a9 T A 4: 111,893,187 Y158F probably damaging Het
Spata3 T A 1: 86,026,453 V114E probably damaging Het
Tbcb T A 7: 30,231,594 I34F possibly damaging Het
Tek T A 4: 94,863,666 Y1014* probably null Het
Togaram1 G T 12: 64,967,907 C644F probably damaging Het
Trim56 A C 5: 137,114,064 D199E possibly damaging Het
Tssk3 A T 4: 129,489,317 D187E probably benign Het
Ttn G A 2: 76,896,803 probably benign Het
Twf2 G A 9: 106,212,826 R126Q probably benign Het
Ugt1a10 T C 1: 88,056,116 M212T probably benign Het
Vmn1r177 A T 7: 23,866,347 F35I possibly damaging Het
Vmn1r44 T A 6: 89,893,933 H77Q possibly damaging Het
Zfp524 G A 7: 5,018,348 V292I probably benign Het
Zfp788 T G 7: 41,647,594 I56S probably benign Het
Other mutations in Col6a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Col6a1 APN 10 76710979 missense unknown
IGL01943:Col6a1 APN 10 76719123 critical splice donor site probably null
IGL02178:Col6a1 APN 10 76711075 missense unknown
IGL02928:Col6a1 APN 10 76709666 missense possibly damaging 0.93
IGL03162:Col6a1 APN 10 76718051 splice site probably benign
P0005:Col6a1 UTSW 10 76717329 splice site probably benign
R0398:Col6a1 UTSW 10 76710118 missense unknown
R0631:Col6a1 UTSW 10 76709735 missense probably benign 0.03
R0698:Col6a1 UTSW 10 76716280 missense unknown
R0699:Col6a1 UTSW 10 76716280 missense unknown
R0848:Col6a1 UTSW 10 76713624 critical splice donor site probably null
R1053:Col6a1 UTSW 10 76720966 missense probably damaging 0.99
R1235:Col6a1 UTSW 10 76712324 missense unknown
R1480:Col6a1 UTSW 10 76709918 missense unknown
R1854:Col6a1 UTSW 10 76721949 missense probably damaging 1.00
R1995:Col6a1 UTSW 10 76721956 missense probably damaging 1.00
R2082:Col6a1 UTSW 10 76709596 missense probably damaging 0.98
R2122:Col6a1 UTSW 10 76721498 missense probably benign 0.10
R2411:Col6a1 UTSW 10 76711088 missense unknown
R3236:Col6a1 UTSW 10 76711320 missense unknown
R3417:Col6a1 UTSW 10 76712369 missense unknown
R3832:Col6a1 UTSW 10 76711117 missense unknown
R3843:Col6a1 UTSW 10 76711341 missense unknown
R3903:Col6a1 UTSW 10 76711341 missense unknown
R3904:Col6a1 UTSW 10 76711341 missense unknown
R4409:Col6a1 UTSW 10 76721500 missense probably benign 0.17
R4418:Col6a1 UTSW 10 76718405 nonsense probably null
R4568:Col6a1 UTSW 10 76719197 intron probably benign
R4661:Col6a1 UTSW 10 76714672 missense unknown
R4945:Col6a1 UTSW 10 76712272 missense unknown
R4958:Col6a1 UTSW 10 76723505 missense probably damaging 1.00
R5101:Col6a1 UTSW 10 76709906 missense unknown
R5440:Col6a1 UTSW 10 76723454 missense probably damaging 1.00
R5924:Col6a1 UTSW 10 76718371 critical splice donor site probably null
R6030:Col6a1 UTSW 10 76709866 missense unknown
R6030:Col6a1 UTSW 10 76709866 missense unknown
R6366:Col6a1 UTSW 10 76710970 missense unknown
R6435:Col6a1 UTSW 10 76711123 missense unknown
R6718:Col6a1 UTSW 10 76725050 missense probably damaging 1.00
R7014:Col6a1 UTSW 10 76721443 missense probably damaging 1.00
R7117:Col6a1 UTSW 10 76725009 missense probably damaging 1.00
R7153:Col6a1 UTSW 10 76710341 splice site probably null
R7183:Col6a1 UTSW 10 76716259 critical splice donor site probably null
R7244:Col6a1 UTSW 10 76717408 nonsense probably null
R7625:Col6a1 UTSW 10 76713926 missense unknown
R7741:Col6a1 UTSW 10 76709909 missense unknown
R7774:Col6a1 UTSW 10 76709876 missense unknown
R7834:Col6a1 UTSW 10 76709928 missense unknown
R8145:Col6a1 UTSW 10 76723471 missense possibly damaging 0.46
R8177:Col6a1 UTSW 10 76725029 missense probably damaging 1.00
RF019:Col6a1 UTSW 10 76711615 missense unknown
X0010:Col6a1 UTSW 10 76723538 missense probably damaging 1.00
X0067:Col6a1 UTSW 10 76709975 missense unknown
Z1088:Col6a1 UTSW 10 76709559 makesense probably null
Predicted Primers PCR Primer
(F):5'- ATCAGCTGATCCTGGACTTCC -3'
(R):5'- GAGTAAGAGCATCCCCAAGATCTC -3'

Sequencing Primer
(F):5'- GGACTTCCCCTCCCCTGG -3'
(R):5'- ATTCCCAGGCCTCTAGCAG -3'
Posted On2015-09-24