Mutagenetix > Incidental Mutation

Incidental Mutation 'R0058:Cgnl1'

34354

Institutional Source

Beutler Lab

Gene Symbol

Cgnl1

Ensembl Gene

ENSMUSG00000032232

Gene Name

cingulin-like 1

Synonyms

Jacop, 9930020M10Rik, 4933421H10Rik

MMRRC Submission

038352-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0058 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

71626509-71771602 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 71724840 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Tryptophan at position 410 (R410W)

Ref Sequence

ENSEMBL: ENSMUSP00000112479 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000072899] [ENSMUST00000121322] [ENSMUST00000122065]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000072899
AA Change: R410W

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000072672
Gene: ENSMUSG00000032232
AA Change: R410W

Domain	Start	End	E-Value	Type
low complexity region	292	309	N/A	INTRINSIC
low complexity region	539	550	N/A	INTRINSIC
low complexity region	615	634	N/A	INTRINSIC
low complexity region	638	653	N/A	INTRINSIC
low complexity region	728	739	N/A	INTRINSIC
Pfam:Myosin_tail_1	984	1255	5.4e-30	PFAM
low complexity region	1258	1278	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000121322
AA Change: R410W

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000113917
Gene: ENSMUSG00000032232
AA Change: R410W

Domain	Start	End	E-Value	Type
low complexity region	292	309	N/A	INTRINSIC
low complexity region	539	550	N/A	INTRINSIC
low complexity region	615	634	N/A	INTRINSIC
low complexity region	638	653	N/A	INTRINSIC
Pfam:Myosin_tail_1	909	1184	2.3e-30	PFAM
low complexity region	1187	1207	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000122065
AA Change: R410W

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000112479
Gene: ENSMUSG00000032232
AA Change: R410W

Domain	Start	End	E-Value	Type
low complexity region	292	309	N/A	INTRINSIC
low complexity region	539	550	N/A	INTRINSIC
Pfam:Myosin_tail_1	582	1034	1.3e-12	PFAM
Pfam:Myosin_tail_1	1011	1253	7.7e-38	PFAM
low complexity region	1258	1278	N/A	INTRINSIC

Meta Mutation Damage Score

0.2740

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.0%
20x: 94.8%

Validation Efficiency

100% (74/74)

MGI Phenotype

FUNCTION: This gene encodes a protein localized to the tight junctions and adherens junctions in vertebrate epithelial cells. The encoded protein regulates the activity of Rho family GTPases during junction assembly and at confluence. At the adherens junctions, the encoded protein is part of a protein complex that links E-cadherin to the microtubule cytoskeleton. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2015]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ache	T	G	5: 137,290,842	V270G	probably damaging	Het
Acss1	A	T	2: 150,628,539	W394R	probably damaging	Het
Adgrv1	A	G	13: 81,182,672	V6088A	possibly damaging	Het
Ankrd36	A	G	11: 5,630,691		probably benign	Het
Anxa1	A	T	19: 20,383,777	Y84N	probably damaging	Het
Arnt2	G	A	7: 84,347,530	R63C	probably damaging	Het
Avpr1b	A	G	1: 131,599,786	T16A	probably benign	Het
Bpifb1	G	A	2: 154,206,540	R165H	possibly damaging	Het
Cables1	A	G	18: 11,923,413	E316G	possibly damaging	Het
Cadm1	A	T	9: 47,850,331	I427L	probably damaging	Het
Ccdc97	T	C	7: 25,715,980	D86G	probably benign	Het
Cntnap4	G	A	8: 112,785,784	E593K	probably damaging	Het
Dazap1	T	C	10: 80,261,581		probably benign	Het
Dip2b	A	G	15: 100,215,240	E1512G	probably benign	Het
Dock1	G	A	7: 135,108,761	V1171M	possibly damaging	Het
Dock5	A	T	14: 67,781,036	F1230Y	probably benign	Het
Dym	G	A	18: 75,043,172	E15K	possibly damaging	Het
Ednra	C	A	8: 77,667,322		probably null	Het
Faf1	A	G	4: 109,736,624	Q133R	probably benign	Het
Fbxw28	A	G	9: 109,328,211	I323T	probably benign	Het
Fcer2a	T	C	8: 3,688,111		probably benign	Het
Fmo2	A	T	1: 162,886,324	S204R	probably benign	Het
Frmd4b	A	G	6: 97,423,499	V63A	probably damaging	Het
Fzd8	G	A	18: 9,213,985	A356T	possibly damaging	Het
Ghitm	A	G	14: 37,131,592	L97P	probably damaging	Het
Gins4	A	G	8: 23,229,510		probably benign	Het
Golga3	T	A	5: 110,202,777	F766Y	possibly damaging	Het
Hapln1	T	C	13: 89,607,878	I267T	probably benign	Het
Helz	A	T	11: 107,672,558		probably benign	Het
Herc2	T	C	7: 56,170,483	V2851A	possibly damaging	Het
Igkv8-18	G	A	6: 70,356,121		probably benign	Het
Igll1	A	T	16: 16,863,876	V5E	probably benign	Het
Irx3	T	C	8: 91,800,540	T179A	possibly damaging	Het
Kif16b	A	G	2: 142,857,305		probably null	Het
Limk1	A	T	5: 134,659,871	W507R	probably damaging	Het
Marf1	C	T	16: 14,142,534	A549T	probably damaging	Het
Mtif3	C	A	5: 146,956,921	V159F	probably benign	Het
Myh6	C	T	14: 54,963,404	R169Q	probably damaging	Het
Ncoa7	T	A	10: 30,647,541	D887V	probably damaging	Het
Obox7	C	T	7: 14,664,388	P76S	probably benign	Het
Olfr1335	A	G	4: 118,809,480	M128T	probably benign	Het
Olfr323	A	T	11: 58,625,668	I126N	probably damaging	Het
Pitpnm2	G	A	5: 124,124,030	A862V	probably damaging	Het
Pkd1	G	C	17: 24,564,703	A162P	probably benign	Het
Plce1	A	G	19: 38,525,184	D309G	possibly damaging	Het
Plk4	T	C	3: 40,805,872	V401A	probably benign	Het
Prdx3	T	C	19: 60,874,512		probably benign	Het
Prrc2c	C	T	1: 162,698,884	V253I	unknown	Het
Ranbp2	T	A	10: 58,480,531	S2358T	probably damaging	Het
Setd2	T	A	9: 110,594,426	V2183E	probably damaging	Het
Sgsm1	T	A	5: 113,285,087	S232C	probably damaging	Het
Skint6	A	T	4: 113,046,815		probably benign	Het
Slc15a2	A	G	16: 36,754,547	I531T	probably benign	Het
Slc36a1	C	T	11: 55,221,994		probably benign	Het
Sorbs2	T	A	8: 45,785,254		probably null	Het
Sorbs2	C	A	8: 45,796,263	D831E	probably damaging	Het
Sptan1	T	C	2: 29,993,696		probably null	Het
Stam	T	C	2: 14,138,141	C336R	probably damaging	Het
Stil	G	T	4: 115,041,298	A1042S	probably damaging	Het
Stxbp5l	T	A	16: 37,142,374	D773V	possibly damaging	Het
Sugct	A	T	13: 17,672,581	L39Q	probably damaging	Het
Tep1	A	G	14: 50,834,065	V2041A	possibly damaging	Het
Tex15	C	T	8: 33,581,502		probably benign	Het
Tlr9	T	G	9: 106,224,965	L485R	possibly damaging	Het
Tmem207	A	G	16: 26,524,829		probably benign	Het
Triml2	T	C	8: 43,185,269		probably benign	Het
Trip6	A	G	5: 137,310,845		probably benign	Het
Tspear	T	C	10: 77,869,631	F288L	probably benign	Het
Vmn1r179	C	T	7: 23,929,167	T261I	possibly damaging	Het
Zfp644	A	T	5: 106,637,003	S559R	possibly damaging	Het

Other mutations in Cgnl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00556:Cgnl1	APN	9	71656056	missense	probably benign	0.00
IGL01128:Cgnl1	APN	9	71724561	missense	possibly damaging	0.81
IGL01450:Cgnl1	APN	9	71631862	splice site	probably benign
IGL01788:Cgnl1	APN	9	71655390	missense	probably benign
IGL01806:Cgnl1	APN	9	71650322	missense	probably damaging	0.99
IGL01906:Cgnl1	APN	9	71724567	missense	probably benign	0.00
IGL01933:Cgnl1	APN	9	71645483	splice site	probably benign
IGL01939:Cgnl1	APN	9	71725004	missense	probably damaging	1.00
IGL01947:Cgnl1	APN	9	71725044	missense	probably damaging	0.99
IGL02127:Cgnl1	APN	9	71725853	missense	probably damaging	1.00
IGL02379:Cgnl1	APN	9	71645553	missense	possibly damaging	0.82
IGL02510:Cgnl1	APN	9	71725357	missense	probably benign	0.41
FR4548:Cgnl1	UTSW	9	71724717	small insertion	probably benign
R0058:Cgnl1	UTSW	9	71641397	missense	probably damaging	1.00
R0105:Cgnl1	UTSW	9	71656102	missense	probably benign
R0220:Cgnl1	UTSW	9	71724943	missense	possibly damaging	0.68
R0242:Cgnl1	UTSW	9	71721657	missense	probably damaging	1.00
R0401:Cgnl1	UTSW	9	71705239	missense	probably damaging	1.00
R0541:Cgnl1	UTSW	9	71651253	missense	possibly damaging	0.54
R1018:Cgnl1	UTSW	9	71726058	missense	probably damaging	1.00
R1026:Cgnl1	UTSW	9	71717431	missense	possibly damaging	0.91
R1056:Cgnl1	UTSW	9	71725895	missense	probably damaging	1.00
R1299:Cgnl1	UTSW	9	71721712	splice site	probably benign
R1513:Cgnl1	UTSW	9	71724590	missense	probably benign	0.02
R1546:Cgnl1	UTSW	9	71725815	missense	probably benign
R1599:Cgnl1	UTSW	9	71641427	missense	probably benign	0.02
R1657:Cgnl1	UTSW	9	71725944	missense	probably damaging	0.98
R1970:Cgnl1	UTSW	9	71725535	missense	probably benign	0.10
R2004:Cgnl1	UTSW	9	71630539	missense	probably damaging	1.00
R2080:Cgnl1	UTSW	9	71656096	missense	probably benign	0.01
R2085:Cgnl1	UTSW	9	71630878	missense	probably damaging	1.00
R2357:Cgnl1	UTSW	9	71725668	nonsense	probably null
R2402:Cgnl1	UTSW	9	71725179	missense	probably damaging	1.00
R3954:Cgnl1	UTSW	9	71724663	missense	probably benign	0.01
R4043:Cgnl1	UTSW	9	71705293	missense	probably damaging	1.00
R4127:Cgnl1	UTSW	9	71724540	missense	probably benign	0.00
R4825:Cgnl1	UTSW	9	71630524	missense	probably benign	0.00
R4851:Cgnl1	UTSW	9	71725032	missense	probably damaging	1.00
R4882:Cgnl1	UTSW	9	71717401	missense	probably benign	0.00
R4996:Cgnl1	UTSW	9	71724826	small deletion	probably benign
R5057:Cgnl1	UTSW	9	71724794	missense	probably damaging	0.99
R5263:Cgnl1	UTSW	9	71632654	nonsense	probably null
R5402:Cgnl1	UTSW	9	71629321	missense	probably damaging	1.00
R5744:Cgnl1	UTSW	9	71630675	splice site	probably null
R5770:Cgnl1	UTSW	9	71645487	splice site	probably null
R6911:Cgnl1	UTSW	9	71656215	missense	possibly damaging	0.82
R7014:Cgnl1	UTSW	9	71725134	missense	possibly damaging	0.86
R7106:Cgnl1	UTSW	9	71725733	missense	probably benign	0.00
R7203:Cgnl1	UTSW	9	71724533	missense	possibly damaging	0.80
R7231:Cgnl1	UTSW	9	71632645	missense	probably benign	0.39
R7241:Cgnl1	UTSW	9	71724770	missense	probably benign
R7288:Cgnl1	UTSW	9	71725564	missense	possibly damaging	0.67
R7327:Cgnl1	UTSW	9	71725883	missense	possibly damaging	0.48
R7390:Cgnl1	UTSW	9	71645649	missense	probably benign	0.04
R7529:Cgnl1	UTSW	9	71631758	missense	probably damaging	1.00
R7793:Cgnl1	UTSW	9	71725635	missense	probably damaging	1.00
R7975:Cgnl1	UTSW	9	71725322	missense	probably benign	0.00
R7990:Cgnl1	UTSW	9	71725265	missense	probably damaging	1.00
R8502:Cgnl1	UTSW	9	71630605	missense	probably damaging	0.99
R8926:Cgnl1	UTSW	9	71725253	missense	probably benign
R9010:Cgnl1	UTSW	9	71651349	missense	probably damaging	1.00
R9106:Cgnl1	UTSW	9	71721591	splice site	probably benign
R9189:Cgnl1	UTSW	9	71723565	nonsense	probably null
R9395:Cgnl1	UTSW	9	71632672	missense	probably benign	0.01
R9680:Cgnl1	UTSW	9	71655350	missense	possibly damaging	0.65
R9694:Cgnl1	UTSW	9	71725521	missense	probably benign	0.32
R9760:Cgnl1	UTSW	9	71645571	nonsense	probably null
RF015:Cgnl1	UTSW	9	71724715	small insertion	probably benign
RF042:Cgnl1	UTSW	9	71724715	small insertion	probably benign

Predicted Primers

PCR Primer
(F):5'- TGTAACATCAACGTGGCAGTGGC -3'
(R):5'- ACCTGCTCAATTCCTGGTGTGGAC -3'

Sequencing Primer
(F):5'- TTGTTCAGAACTTTCCCATCTTTG -3'
(R):5'- ACGACAGGAAAAGATCCCGA -3'

Posted On

2013-05-09