Incidental Mutation 'R4580:Nphp1'
ID343566
Institutional Source Beutler Lab
Gene Symbol Nphp1
Ensembl Gene ENSMUSG00000027378
Gene Namenephronophthisis 1 (juvenile) homolog (human)
Synonymsnephrocystin
MMRRC Submission 041599-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4580 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location127740732-127788897 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 127768169 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000105986 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028857] [ENSMUST00000110357]
Predicted Effect probably null
Transcript: ENSMUST00000028857
SMART Domains Protein: ENSMUSP00000028857
Gene: ENSMUSG00000027378

DomainStartEndE-ValueType
low complexity region 118 143 N/A INTRINSIC
SH3 158 214 5.91e-19 SMART
low complexity region 220 246 N/A INTRINSIC
Blast:14_3_3 391 491 3e-55 BLAST
low complexity region 634 641 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000110357
SMART Domains Protein: ENSMUSP00000105986
Gene: ENSMUSG00000027378

DomainStartEndE-ValueType
low complexity region 118 143 N/A INTRINSIC
SH3 158 214 5.91e-19 SMART
low complexity region 220 246 N/A INTRINSIC
Blast:14_3_3 390 490 3e-55 BLAST
low complexity region 633 640 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with src homology domain 3 (SH3) patterns. This protein interacts with Crk-associated substrate, and it appears to function in the control of cell division, as well as in cell-cell and cell-matrix adhesion signaling, likely as part of a multifunctional complex localized in actin- and microtubule-based structures. Mutations in this gene cause familial juvenile nephronophthisis type 1, a kidney disorder involving both tubules and glomeruli. Defects in this gene are also associated with Senior-Loken syndrome type 1, also referred to as juvenile nephronophthisis with Leber amaurosis, which is characterized by kidney and eye disease, and with Joubert syndrome type 4, which is characterized by cerebellar ataxia, oculomotor apraxia, psychomotor delay and neonatal breathing abnormalities, sometimes including retinal dystrophy and renal disease. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit male infertility due to defects in sperm maturation. Mice homozygous for another knock-out allele exhibit absent photoreceptor outer segment and photoreceptor degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810408A11Rik T C 11: 69,900,411 Y114C probably damaging Het
4932438A13Rik A T 3: 37,030,025 T3864S probably benign Het
Abcc2 T C 19: 43,811,119 S556P probably damaging Het
AI314180 T C 4: 58,840,751 Y669C probably damaging Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Atp6v1g1 A G 4: 63,550,032 N91D probably benign Het
BC005537 G T 13: 24,803,411 A11S probably benign Het
BC049352 G T 9: 45,244,128 probably null Het
Bub1 A C 2: 127,829,676 probably null Het
Ccdc162 T C 10: 41,561,140 T1758A probably benign Het
Cdh15 T C 8: 122,865,158 L594P probably damaging Het
Cobll1 C T 2: 65,151,073 V90I probably benign Het
Cog2 T C 8: 124,545,136 V463A probably benign Het
Cpeb4 T A 11: 31,927,757 probably null Het
Creb5 G A 6: 53,604,534 M172I possibly damaging Het
Cyp4a32 T C 4: 115,602,929 silent Het
Dnah8 T A 17: 30,662,052 S588T probably benign Het
Esd T C 14: 74,742,077 V120A possibly damaging Het
Fbxo5 T C 10: 5,805,255 probably null Het
Gm4922 T C 10: 18,783,684 D430G probably benign Het
Golga4 C A 9: 118,557,259 Q1150K probably benign Het
Grb14 T C 2: 64,953,603 N60S probably benign Het
Grk4 A G 5: 34,660,981 N2S probably damaging Het
Henmt1 T A 3: 108,942,765 S21R probably benign Het
Ifngr2 A G 16: 91,558,018 K113E probably benign Het
Ighv15-2 T A 12: 114,564,970 T15S probably benign Het
Kif24 A G 4: 41,395,287 S529P probably damaging Het
Large2 T C 2: 92,370,612 N51S possibly damaging Het
Lmtk2 A G 5: 144,174,781 E773G possibly damaging Het
Lrfn3 A T 7: 30,360,042 C253S probably damaging Het
Maea T C 5: 33,360,488 V130A possibly damaging Het
March11 A T 15: 26,311,103 I222F probably damaging Het
Mast4 A T 13: 102,737,258 Y1699* probably null Het
Mavs G T 2: 131,240,450 A85S probably damaging Het
Mpzl3 T A 9: 45,068,231 V160E possibly damaging Het
Myh15 T C 16: 49,065,025 S88P possibly damaging Het
Myl2 A T 5: 122,106,738 H157L probably benign Het
Myo9b A G 8: 71,315,135 N284S probably damaging Het
Nrcam T C 12: 44,562,540 probably null Het
Nt5c3b G T 11: 100,433,059 F134L probably damaging Het
Olfr1225 T A 2: 89,171,200 Q4L probably benign Het
Otog A G 7: 46,287,801 R1645G possibly damaging Het
Pask T C 1: 93,322,108 I523M probably benign Het
Pcdhb7 T A 18: 37,342,135 L108Q probably damaging Het
Pdp2 C A 8: 104,594,944 T475K probably damaging Het
Pgbd1 G C 13: 21,428,329 P113A probably benign Het
Plk5 C T 10: 80,360,467 H291Y possibly damaging Het
Pmpca G T 2: 26,393,335 S382I probably damaging Het
Prl3b1 A G 13: 27,249,467 T202A possibly damaging Het
Ptgs2 A T 1: 150,104,094 T317S possibly damaging Het
Ptprc C T 1: 138,071,251 M1020I probably benign Het
Rhbdl3 T C 11: 80,353,645 Y393H probably damaging Het
Sema3e T C 5: 14,233,703 L482P probably damaging Het
Setd2 C T 9: 110,574,243 T1984I probably benign Het
Slc17a1 T C 13: 23,887,977 Y393H probably damaging Het
Slc9a3 C T 13: 74,158,886 R377* probably null Het
Slitrk3 A G 3: 73,051,206 S78P probably damaging Het
Specc1 T A 11: 62,219,331 V1054E probably damaging Het
Tbc1d4 T C 14: 101,458,783 T847A probably benign Het
Tcf7l2 G A 19: 55,919,036 G343R probably damaging Het
Tex36 A C 7: 133,587,382 Y154D possibly damaging Het
Topaz1 T A 9: 122,747,515 M57K probably null Het
Trav6-4 T C 14: 53,454,699 Y85H probably damaging Het
Trim30d A G 7: 104,472,558 Y327H possibly damaging Het
Ttn A G 2: 76,951,396 V1056A probably benign Het
Usp32 C A 11: 85,059,127 probably null Het
Vmn1r59 A T 7: 5,454,137 M208K probably damaging Het
Vmn2r25 T C 6: 123,823,023 T787A possibly damaging Het
Vps39 A T 2: 120,339,333 I246N probably benign Het
Xab2 T C 8: 3,610,162 D855G probably damaging Het
Xpc A G 6: 91,500,011 S369P probably benign Het
Ythdc2 T A 18: 44,858,198 C758S possibly damaging Het
Zfp62 A G 11: 49,216,272 I397V possibly damaging Het
Zscan4d A G 7: 11,162,508 S312P probably benign Het
Other mutations in Nphp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00570:Nphp1 APN 2 127763885 missense probably damaging 0.99
IGL00589:Nphp1 APN 2 127763849 missense probably damaging 1.00
IGL01143:Nphp1 APN 2 127780136 missense probably benign 0.06
IGL01893:Nphp1 APN 2 127769644 missense probably damaging 1.00
IGL01922:Nphp1 APN 2 127780069 missense possibly damaging 0.95
IGL02123:Nphp1 APN 2 127754049 missense probably benign 0.03
IGL02340:Nphp1 APN 2 127780067 nonsense probably null
IGL02836:Nphp1 APN 2 127769623 missense probably benign 0.00
IGL03109:Nphp1 APN 2 127768169 critical splice donor site probably benign
R1632:Nphp1 UTSW 2 127770392 missense probably benign 0.32
R1857:Nphp1 UTSW 2 127770376 missense probably benign 0.00
R4425:Nphp1 UTSW 2 127788799 missense possibly damaging 0.82
R4514:Nphp1 UTSW 2 127748087 missense probably benign 0.26
R4546:Nphp1 UTSW 2 127766019 splice site probably null
R5634:Nphp1 UTSW 2 127759650 missense possibly damaging 0.81
R7152:Nphp1 UTSW 2 127753979 missense probably benign
R7326:Nphp1 UTSW 2 127761217 missense possibly damaging 0.76
R8029:Nphp1 UTSW 2 127741116 missense probably benign 0.00
X0022:Nphp1 UTSW 2 127761214 missense probably damaging 1.00
X0025:Nphp1 UTSW 2 127779127 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- AGAAGCCATGTTTGTGCAAC -3'
(R):5'- GCCGTTGCAATAGTGTTGAAG -3'

Sequencing Primer
(F):5'- ATGTGAACTTCAGGACCTCAG -3'
(R):5'- CCGTTGCAATAGTGTTGAAGTACTAC -3'
Posted On2015-09-24