Mutagenetix > Incidental Mutations

Incidental Mutation 'R4580:AI314180'

343574

Institutional Source

Beutler Lab

Gene Symbol

AI314180

Ensembl Gene

ENSMUSG00000050812

Gene Name

expressed sequence AI314180

Synonyms

MMRRC Submission

041599-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.360) question?

Stock #

R4580 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

58798911-58912749 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 58840751 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 669 (Y669C)

Ref Sequence

ENSEMBL: ENSMUSP00000117585 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102889] [ENSMUST00000107557] [ENSMUST00000144512] [ENSMUST00000149301]

Predicted Effect

probably damaging
Transcript: ENSMUST00000102889
AA Change: Y669C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000099953
Gene: ENSMUSG00000050812
AA Change: Y669C

Domain	Start	End	E-Value	Type
Pfam:Ecm29	10	517	1.1e-155	PFAM
low complexity region	627	642	N/A	INTRINSIC
low complexity region	653	665	N/A	INTRINSIC
SCOP:d1qbkb_	693	1491	3e-31	SMART
low complexity region	1781	1797	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000107557
AA Change: Y669C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000103182
Gene: ENSMUSG00000050812
AA Change: Y669C

Domain	Start	End	E-Value	Type
Pfam:Ecm29	10	517	7.6e-164	PFAM
low complexity region	627	642	N/A	INTRINSIC
low complexity region	653	665	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000144512

SMART Domains

Protein: ENSMUSP00000118103
Gene: ENSMUSG00000050812

Domain	Start	End	E-Value	Type
Pfam:Ecm29	10	517	2.3e-164	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000149301
AA Change: Y669C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000117585
Gene: ENSMUSG00000050812
AA Change: Y669C

Domain	Start	End	E-Value	Type
Pfam:Ecm29	10	517	4e-163	PFAM
low complexity region	627	642	N/A	INTRINSIC
low complexity region	653	665	N/A	INTRINSIC
SCOP:d1qbkb_	693	1490	8e-32	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151869

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.1%
20x: 94.9%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810408A11Rik	T	C	11: 69,900,411	Y114C	probably damaging	Het
4932438A13Rik	A	T	3: 37,030,025	T3864S	probably benign	Het
Abcc2	T	C	19: 43,811,119	S556P	probably damaging	Het
Arl6ip1	AAAATAAATAAATAAATAAATAAATA	AAAATAAATAAATAAATAAATAAATAAATA	7: 118,121,899		probably benign	Het
Atp6v1g1	A	G	4: 63,550,032	N91D	probably benign	Het
BC005537	G	T	13: 24,803,411	A11S	probably benign	Het
BC049352	G	T	9: 45,244,128		probably null	Het
Bub1	A	C	2: 127,829,676		probably null	Het
Ccdc162	T	C	10: 41,561,140	T1758A	probably benign	Het
Cdh15	T	C	8: 122,865,158	L594P	probably damaging	Het
Cobll1	C	T	2: 65,151,073	V90I	probably benign	Het
Cog2	T	C	8: 124,545,136	V463A	probably benign	Het
Cpeb4	T	A	11: 31,927,757		probably null	Het
Creb5	G	A	6: 53,604,534	M172I	possibly damaging	Het
Cyp4a32	T	C	4: 115,602,929		silent	Het
Dnah8	T	A	17: 30,662,052	S588T	probably benign	Het
Esd	T	C	14: 74,742,077	V120A	possibly damaging	Het
Fbxo5	T	C	10: 5,805,255		probably null	Het
Gm4922	T	C	10: 18,783,684	D430G	probably benign	Het
Golga4	C	A	9: 118,557,259	Q1150K	probably benign	Het
Grb14	T	C	2: 64,953,603	N60S	probably benign	Het
Grk4	A	G	5: 34,660,981	N2S	probably damaging	Het
Henmt1	T	A	3: 108,942,765	S21R	probably benign	Het
Ifngr2	A	G	16: 91,558,018	K113E	probably benign	Het
Ighv15-2	T	A	12: 114,564,970	T15S	probably benign	Het
Kif24	A	G	4: 41,395,287	S529P	probably damaging	Het
Large2	T	C	2: 92,370,612	N51S	possibly damaging	Het
Lmtk2	A	G	5: 144,174,781	E773G	possibly damaging	Het
Lrfn3	A	T	7: 30,360,042	C253S	probably damaging	Het
Maea	T	C	5: 33,360,488	V130A	possibly damaging	Het
March11	A	T	15: 26,311,103	I222F	probably damaging	Het
Mast4	A	T	13: 102,737,258	Y1699*	probably null	Het
Mavs	G	T	2: 131,240,450	A85S	probably damaging	Het
Mpzl3	T	A	9: 45,068,231	V160E	possibly damaging	Het
Myh15	T	C	16: 49,065,025	S88P	possibly damaging	Het
Myl2	A	T	5: 122,106,738	H157L	probably benign	Het
Myo9b	A	G	8: 71,315,135	N284S	probably damaging	Het
Nphp1	A	G	2: 127,768,169		probably null	Het
Nrcam	T	C	12: 44,562,540		probably null	Het
Nt5c3b	G	T	11: 100,433,059	F134L	probably damaging	Het
Olfr1225	T	A	2: 89,171,200	Q4L	probably benign	Het
Otog	A	G	7: 46,287,801	R1645G	possibly damaging	Het
Pask	T	C	1: 93,322,108	I523M	probably benign	Het
Pcdhb7	T	A	18: 37,342,135	L108Q	probably damaging	Het
Pdp2	C	A	8: 104,594,944	T475K	probably damaging	Het
Pgbd1	G	C	13: 21,428,329	P113A	probably benign	Het
Plk5	C	T	10: 80,360,467	H291Y	possibly damaging	Het
Pmpca	G	T	2: 26,393,335	S382I	probably damaging	Het
Prl3b1	A	G	13: 27,249,467	T202A	possibly damaging	Het
Ptgs2	A	T	1: 150,104,094	T317S	possibly damaging	Het
Ptprc	C	T	1: 138,071,251	M1020I	probably benign	Het
Rhbdl3	T	C	11: 80,353,645	Y393H	probably damaging	Het
Sema3e	T	C	5: 14,233,703	L482P	probably damaging	Het
Setd2	C	T	9: 110,574,243	T1984I	probably benign	Het
Slc17a1	T	C	13: 23,887,977	Y393H	probably damaging	Het
Slc9a3	C	T	13: 74,158,886	R377*	probably null	Het
Slitrk3	A	G	3: 73,051,206	S78P	probably damaging	Het
Specc1	T	A	11: 62,219,331	V1054E	probably damaging	Het
Tbc1d4	T	C	14: 101,458,783	T847A	probably benign	Het
Tcf7l2	G	A	19: 55,919,036	G343R	probably damaging	Het
Tex36	A	C	7: 133,587,382	Y154D	possibly damaging	Het
Topaz1	T	A	9: 122,747,515	M57K	probably null	Het
Trav6-4	T	C	14: 53,454,699	Y85H	probably damaging	Het
Trim30d	A	G	7: 104,472,558	Y327H	possibly damaging	Het
Ttn	A	G	2: 76,951,396	V1056A	probably benign	Het
Usp32	C	A	11: 85,059,127		probably null	Het
Vmn1r59	A	T	7: 5,454,137	M208K	probably damaging	Het
Vmn2r25	T	C	6: 123,823,023	T787A	possibly damaging	Het
Vps39	A	T	2: 120,339,333	I246N	probably benign	Het
Xab2	T	C	8: 3,610,162	D855G	probably damaging	Het
Xpc	A	G	6: 91,500,011	S369P	probably benign	Het
Ythdc2	T	A	18: 44,858,198	C758S	possibly damaging	Het
Zfp62	A	G	11: 49,216,272	I397V	possibly damaging	Het
Zscan4d	A	G	7: 11,162,508	S312P	probably benign	Het

Other mutations in AI314180

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00799:AI314180	APN	4	58828047	missense	possibly damaging	0.95
IGL01145:AI314180	APN	4	58811501	missense	probably null	0.08
IGL01371:AI314180	APN	4	58809718	missense	probably damaging	1.00
IGL01445:AI314180	APN	4	58833988	missense	probably benign	0.08
IGL01452:AI314180	APN	4	58836181	missense	probably damaging	0.99
IGL01626:AI314180	APN	4	58832814	splice site	probably benign
IGL01672:AI314180	APN	4	58814041	missense	probably benign	0.40
IGL01943:AI314180	APN	4	58849937	missense	possibly damaging	0.91
IGL01944:AI314180	APN	4	58861544	missense	probably benign	0.42
IGL02190:AI314180	APN	4	58800190	missense	probably benign	0.12
IGL02272:AI314180	APN	4	58811731	missense	probably benign	0.00
IGL02435:AI314180	APN	4	58830325	splice site	probably benign
IGL02516:AI314180	APN	4	58877102	missense	probably damaging	1.00
IGL02540:AI314180	APN	4	58805534	splice site	probably benign
IGL02709:AI314180	APN	4	58872699	missense	possibly damaging	0.90
IGL02742:AI314180	APN	4	58840757	missense	probably damaging	0.96
IGL02812:AI314180	APN	4	58864343	splice site	probably benign
IGL02828:AI314180	APN	4	58875512	missense	possibly damaging	0.59
IGL03130:AI314180	APN	4	58800288	missense	probably benign
IGL03179:AI314180	APN	4	58832777	missense	probably damaging	1.00
IGL03237:AI314180	APN	4	58810668	missense	probably benign	0.40
IGL03344:AI314180	APN	4	58828538	missense	probably damaging	1.00
BB006:AI314180	UTSW	4	58869554	missense	probably damaging	1.00
BB016:AI314180	UTSW	4	58869554	missense	probably damaging	1.00
R0051:AI314180	UTSW	4	58832729	missense	probably damaging	1.00
R0051:AI314180	UTSW	4	58832729	missense	probably damaging	1.00
R0313:AI314180	UTSW	4	58811892	missense	probably benign	0.11
R0399:AI314180	UTSW	4	58827047	missense	possibly damaging	0.69
R0487:AI314180	UTSW	4	58819155	missense	probably damaging	1.00
R0492:AI314180	UTSW	4	58864418	missense	probably damaging	1.00
R0705:AI314180	UTSW	4	58885366	critical splice donor site	probably null
R0847:AI314180	UTSW	4	58841439	missense	probably benign	0.14
R1467:AI314180	UTSW	4	58832753	missense	probably benign
R1467:AI314180	UTSW	4	58832753	missense	probably benign
R1482:AI314180	UTSW	4	58820163	missense	possibly damaging	0.85
R1529:AI314180	UTSW	4	58832701	splice site	probably null
R1771:AI314180	UTSW	4	58879100	missense	probably damaging	1.00
R1776:AI314180	UTSW	4	58879100	missense	probably damaging	1.00
R1822:AI314180	UTSW	4	58805539	critical splice donor site	probably null
R1864:AI314180	UTSW	4	58849942	missense	possibly damaging	0.62
R2029:AI314180	UTSW	4	58844165	nonsense	probably null
R2061:AI314180	UTSW	4	58824270	missense	probably damaging	1.00
R2125:AI314180	UTSW	4	58833978	missense	probably benign
R2266:AI314180	UTSW	4	58830332	critical splice donor site	probably null
R2889:AI314180	UTSW	4	58836165	missense	probably benign
R2902:AI314180	UTSW	4	58809691	missense	probably benign	0.31
R2903:AI314180	UTSW	4	58828622	missense	possibly damaging	0.50
R2925:AI314180	UTSW	4	58833928	nonsense	probably null
R4151:AI314180	UTSW	4	58836254	missense	possibly damaging	0.51
R4225:AI314180	UTSW	4	58847027	missense	probably damaging	1.00
R4486:AI314180	UTSW	4	58820086	intron	probably benign
R4576:AI314180	UTSW	4	58834708	intron	probably benign
R4654:AI314180	UTSW	4	58834523	missense	possibly damaging	0.86
R4688:AI314180	UTSW	4	58840757	missense	probably damaging	0.96
R4726:AI314180	UTSW	4	58844191	missense	probably damaging	1.00
R4825:AI314180	UTSW	4	58850911	missense	probably damaging	0.99
R4928:AI314180	UTSW	4	58827073	missense	probably damaging	1.00
R5098:AI314180	UTSW	4	58877048	missense	probably damaging	1.00
R5284:AI314180	UTSW	4	58836172	missense	possibly damaging	0.90
R5375:AI314180	UTSW	4	58809401	nonsense	probably null
R5382:AI314180	UTSW	4	58850934	missense	probably benign	0.38
R5487:AI314180	UTSW	4	58809421	missense	probably benign	0.22
R5703:AI314180	UTSW	4	58877171	splice site	probably null
R5761:AI314180	UTSW	4	58853131	missense	probably damaging	1.00
R5791:AI314180	UTSW	4	58814027	missense	possibly damaging	0.90
R5791:AI314180	UTSW	4	58822111	missense	probably damaging	1.00
R5928:AI314180	UTSW	4	58849948	missense	possibly damaging	0.59
R6062:AI314180	UTSW	4	58826453	missense	possibly damaging	0.84
R6246:AI314180	UTSW	4	58811365	splice site	probably null
R6298:AI314180	UTSW	4	58877157	missense	probably damaging	1.00
R6326:AI314180	UTSW	4	58827068	missense	probably benign	0.34
R6478:AI314180	UTSW	4	58810785	missense	probably damaging	1.00
R6707:AI314180	UTSW	4	58879101	missense	possibly damaging	0.52
R6846:AI314180	UTSW	4	58814081	missense	possibly damaging	0.85
R6857:AI314180	UTSW	4	58814065	missense	probably damaging	1.00
R6951:AI314180	UTSW	4	58853114	critical splice donor site	probably null
R7088:AI314180	UTSW	4	58849766	missense	possibly damaging	0.93
R7302:AI314180	UTSW	4	58834593	missense	probably benign	0.43
R7337:AI314180	UTSW	4	58827047	missense	possibly damaging	0.69
R7341:AI314180	UTSW	4	58809415	missense	possibly damaging	0.94
R7344:AI314180	UTSW	4	58824770	missense	probably benign	0.08
R7525:AI314180	UTSW	4	58847038	missense	possibly damaging	0.84
R7530:AI314180	UTSW	4	58815317	missense	probably damaging	0.99
R7533:AI314180	UTSW	4	58809411	missense	probably benign	0.12
R7557:AI314180	UTSW	4	58849691	missense	possibly damaging	0.85
R7698:AI314180	UTSW	4	58832660	missense	unknown
R7793:AI314180	UTSW	4	58853150	missense	probably damaging	1.00
R7892:AI314180	UTSW	4	58828593	missense	probably benign
R7894:AI314180	UTSW	4	58853708	missense	probably damaging	1.00
R7929:AI314180	UTSW	4	58869554	missense	probably damaging	1.00
R8010:AI314180	UTSW	4	58832681	missense	unknown
R8082:AI314180	UTSW	4	58807852	missense	probably benign	0.00
R8175:AI314180	UTSW	4	58872756	missense	probably damaging	1.00
R8191:AI314180	UTSW	4	58872587	critical splice donor site	probably null
R8326:AI314180	UTSW	4	58847093	missense	probably damaging	1.00
R8459:AI314180	UTSW	4	58821379	missense	probably damaging	1.00
X0060:AI314180	UTSW	4	58840752	missense	possibly damaging	0.73
Z1177:AI314180	UTSW	4	58861614	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GCATGTTTGTCAGAGGCAAG -3'
(R):5'- CACGAGAAGACAGGGCATCC -3'

Sequencing Primer
(F):5'- TTTAAGGAGGCAGTACACAATTACAG -3'
(R):5'- CGAGAAGACAGGGCATCCTTTTG -3'

Posted On

2015-09-24