Incidental Mutation 'R4580:Sema3e'
ID343577
Institutional Source Beutler Lab
Gene Symbol Sema3e
Ensembl Gene ENSMUSG00000063531
Gene Namesema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3E
SynonymsSemah
MMRRC Submission 041599-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.551) question?
Stock #R4580 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location14025276-14256689 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 14233703 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 482 (L482P)
Ref Sequence ENSEMBL: ENSMUSP00000073612 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073957]
Predicted Effect probably damaging
Transcript: ENSMUST00000073957
AA Change: L482P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073612
Gene: ENSMUSG00000063531
AA Change: L482P

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Sema 58 500 1.85e-194 SMART
PSI 518 573 1.81e-10 SMART
IG 587 673 5.75e-4 SMART
low complexity region 737 750 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130116
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199698
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Semaphorins are a large family of conserved secreted and membrane associated proteins which possess a semaphorin (Sema) domain and a PSI domain (found in plexins, semaphorins and integrins) in the N-terminal extracellular portion. Based on sequence and structural similarities, semaphorins are put into eight classes: invertebrates contain classes 1 and 2, viruses have class V, and vertebrates contain classes 3-7. Semaphorins serve as axon guidance ligands via multimeric receptor complexes, some (if not all) containing plexin proteins. This gene encodes a class 4 semaphorin. This gene encodes a class 3 semaphorin. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, May 2010]
PHENOTYPE: Homozygous null mice display abnormal intersomitic vacular development and loss of the normal segmented somite pattern. Homozygous mutants for another allele have Bergmeister papillae on the surface of the optic disc. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810408A11Rik T C 11: 69,900,411 Y114C probably damaging Het
4932438A13Rik A T 3: 37,030,025 T3864S probably benign Het
Abcc2 T C 19: 43,811,119 S556P probably damaging Het
AI314180 T C 4: 58,840,751 Y669C probably damaging Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Atp6v1g1 A G 4: 63,550,032 N91D probably benign Het
BC005537 G T 13: 24,803,411 A11S probably benign Het
BC049352 G T 9: 45,244,128 probably null Het
Bub1 A C 2: 127,829,676 probably null Het
Ccdc162 T C 10: 41,561,140 T1758A probably benign Het
Cdh15 T C 8: 122,865,158 L594P probably damaging Het
Cobll1 C T 2: 65,151,073 V90I probably benign Het
Cog2 T C 8: 124,545,136 V463A probably benign Het
Cpeb4 T A 11: 31,927,757 probably null Het
Creb5 G A 6: 53,604,534 M172I possibly damaging Het
Cyp4a32 T C 4: 115,602,929 silent Het
Dnah8 T A 17: 30,662,052 S588T probably benign Het
Esd T C 14: 74,742,077 V120A possibly damaging Het
Fbxo5 T C 10: 5,805,255 probably null Het
Gm4922 T C 10: 18,783,684 D430G probably benign Het
Golga4 C A 9: 118,557,259 Q1150K probably benign Het
Grb14 T C 2: 64,953,603 N60S probably benign Het
Grk4 A G 5: 34,660,981 N2S probably damaging Het
Henmt1 T A 3: 108,942,765 S21R probably benign Het
Ifngr2 A G 16: 91,558,018 K113E probably benign Het
Ighv15-2 T A 12: 114,564,970 T15S probably benign Het
Kif24 A G 4: 41,395,287 S529P probably damaging Het
Large2 T C 2: 92,370,612 N51S possibly damaging Het
Lmtk2 A G 5: 144,174,781 E773G possibly damaging Het
Lrfn3 A T 7: 30,360,042 C253S probably damaging Het
Maea T C 5: 33,360,488 V130A possibly damaging Het
March11 A T 15: 26,311,103 I222F probably damaging Het
Mast4 A T 13: 102,737,258 Y1699* probably null Het
Mavs G T 2: 131,240,450 A85S probably damaging Het
Mpzl3 T A 9: 45,068,231 V160E possibly damaging Het
Myh15 T C 16: 49,065,025 S88P possibly damaging Het
Myl2 A T 5: 122,106,738 H157L probably benign Het
Myo9b A G 8: 71,315,135 N284S probably damaging Het
Nphp1 A G 2: 127,768,169 probably null Het
Nrcam T C 12: 44,562,540 probably null Het
Nt5c3b G T 11: 100,433,059 F134L probably damaging Het
Olfr1225 T A 2: 89,171,200 Q4L probably benign Het
Otog A G 7: 46,287,801 R1645G possibly damaging Het
Pask T C 1: 93,322,108 I523M probably benign Het
Pcdhb7 T A 18: 37,342,135 L108Q probably damaging Het
Pdp2 C A 8: 104,594,944 T475K probably damaging Het
Pgbd1 G C 13: 21,428,329 P113A probably benign Het
Plk5 C T 10: 80,360,467 H291Y possibly damaging Het
Pmpca G T 2: 26,393,335 S382I probably damaging Het
Prl3b1 A G 13: 27,249,467 T202A possibly damaging Het
Ptgs2 A T 1: 150,104,094 T317S possibly damaging Het
Ptprc C T 1: 138,071,251 M1020I probably benign Het
Rhbdl3 T C 11: 80,353,645 Y393H probably damaging Het
Setd2 C T 9: 110,574,243 T1984I probably benign Het
Slc17a1 T C 13: 23,887,977 Y393H probably damaging Het
Slc9a3 C T 13: 74,158,886 R377* probably null Het
Slitrk3 A G 3: 73,051,206 S78P probably damaging Het
Specc1 T A 11: 62,219,331 V1054E probably damaging Het
Tbc1d4 T C 14: 101,458,783 T847A probably benign Het
Tcf7l2 G A 19: 55,919,036 G343R probably damaging Het
Tex36 A C 7: 133,587,382 Y154D possibly damaging Het
Topaz1 T A 9: 122,747,515 M57K probably null Het
Trav6-4 T C 14: 53,454,699 Y85H probably damaging Het
Trim30d A G 7: 104,472,558 Y327H possibly damaging Het
Ttn A G 2: 76,951,396 V1056A probably benign Het
Usp32 C A 11: 85,059,127 probably null Het
Vmn1r59 A T 7: 5,454,137 M208K probably damaging Het
Vmn2r25 T C 6: 123,823,023 T787A possibly damaging Het
Vps39 A T 2: 120,339,333 I246N probably benign Het
Xab2 T C 8: 3,610,162 D855G probably damaging Het
Xpc A G 6: 91,500,011 S369P probably benign Het
Ythdc2 T A 18: 44,858,198 C758S possibly damaging Het
Zfp62 A G 11: 49,216,272 I397V possibly damaging Het
Zscan4d A G 7: 11,162,508 S312P probably benign Het
Other mutations in Sema3e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Sema3e APN 5 14240572 missense probably damaging 1.00
IGL01068:Sema3e APN 5 14233718 critical splice donor site probably null
IGL01128:Sema3e APN 5 14232115 missense probably damaging 1.00
IGL01134:Sema3e APN 5 14252770 missense probably damaging 1.00
IGL02013:Sema3e APN 5 14230193 missense probably damaging 1.00
IGL02051:Sema3e APN 5 14224310 missense possibly damaging 0.77
IGL02309:Sema3e APN 5 14224390 missense probably damaging 0.98
IGL02636:Sema3e APN 5 14225656 missense probably benign
IGL02702:Sema3e APN 5 14233726 splice site probably benign
IGL03001:Sema3e APN 5 14241043 missense probably benign 0.19
R0011:Sema3e UTSW 5 14144011 nonsense probably null
R0098:Sema3e UTSW 5 14252432 missense possibly damaging 0.52
R0098:Sema3e UTSW 5 14252432 missense possibly damaging 0.52
R0220:Sema3e UTSW 5 14164153 missense possibly damaging 0.56
R0564:Sema3e UTSW 5 14236085 critical splice donor site probably null
R1079:Sema3e UTSW 5 14225655 missense probably benign 0.12
R1187:Sema3e UTSW 5 14232084 missense probably damaging 1.00
R1670:Sema3e UTSW 5 14162185 splice site probably benign
R1736:Sema3e UTSW 5 14210376 missense probably damaging 1.00
R3433:Sema3e UTSW 5 14252714 missense probably benign 0.00
R3831:Sema3e UTSW 5 14226482 missense probably damaging 1.00
R4094:Sema3e UTSW 5 14233690 missense probably benign 0.12
R4828:Sema3e UTSW 5 14226640 missense probably damaging 1.00
R4855:Sema3e UTSW 5 14230130 missense probably damaging 0.99
R4884:Sema3e UTSW 5 14225565 missense probably damaging 1.00
R4960:Sema3e UTSW 5 14252632 missense possibly damaging 0.93
R5264:Sema3e UTSW 5 14226648 missense probably damaging 1.00
R5389:Sema3e UTSW 5 14236085 critical splice donor site probably benign
R5512:Sema3e UTSW 5 14230180 missense probably damaging 1.00
R5642:Sema3e UTSW 5 14162243 missense probably damaging 1.00
R5647:Sema3e UTSW 5 14225553 missense probably damaging 0.99
R5814:Sema3e UTSW 5 14225666 missense probably benign 0.01
R5993:Sema3e UTSW 5 14224293 missense probably damaging 1.00
R6076:Sema3e UTSW 5 14241086 missense probably benign 0.01
R6906:Sema3e UTSW 5 14240587 missense probably damaging 1.00
R7432:Sema3e UTSW 5 14224390 missense probably damaging 0.98
X0064:Sema3e UTSW 5 14230142 missense probably benign 0.05
Z1088:Sema3e UTSW 5 14226456 missense probably damaging 0.97
Z1177:Sema3e UTSW 5 14025711 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TCAAAGCTCATTTAGAACATTCAGG -3'
(R):5'- GTGTGCCCTTAGGACAGTGG -3'

Sequencing Primer
(F):5'- GCAGTCTTCCAAAGACTC -3'
(R):5'- GGCACTTTTGAGCATTCTGACAATG -3'
Posted On2015-09-24