Incidental Mutation 'R4580:Myl2'
ID343580
Institutional Source Beutler Lab
Gene Symbol Myl2
Ensembl Gene ENSMUSG00000013936
Gene Namemyosin, light polypeptide 2, regulatory, cardiac, slow
SynonymsMlc2v, MLC-2v, MLC-2, Mylpc
MMRRC Submission 041599-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4580 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location122100951-122113472 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 122106738 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 157 (H157L)
Ref Sequence ENSEMBL: ENSMUSP00000107380 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014080] [ENSMUST00000058960] [ENSMUST00000111750] [ENSMUST00000111751] [ENSMUST00000139213] [ENSMUST00000146733] [ENSMUST00000150535] [ENSMUST00000152389] [ENSMUST00000155612]
Predicted Effect probably benign
Transcript: ENSMUST00000014080
AA Change: H157L

PolyPhen 2 Score 0.374 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000014080
Gene: ENSMUSG00000013936
AA Change: H157L

DomainStartEndE-ValueType
EFh 28 56 2.81e-5 SMART
EFh 98 126 4.53e0 SMART
EFh 134 162 3.97e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000058960
SMART Domains Protein: ENSMUSP00000050582
Gene: ENSMUSG00000043036

DomainStartEndE-ValueType
coiled coil region 140 158 N/A INTRINSIC
coiled coil region 209 285 N/A INTRINSIC
low complexity region 308 318 N/A INTRINSIC
coiled coil region 393 438 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111750
SMART Domains Protein: ENSMUSP00000107379
Gene: ENSMUSG00000013936

DomainStartEndE-ValueType
EFh 28 56 2.81e-5 SMART
EFh 98 126 4.53e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111751
AA Change: H157L

PolyPhen 2 Score 0.374 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000107380
Gene: ENSMUSG00000013936
AA Change: H157L

DomainStartEndE-ValueType
EFh 28 56 2.81e-5 SMART
EFh 98 126 4.53e0 SMART
EFh 134 162 3.97e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123913
Predicted Effect probably benign
Transcript: ENSMUST00000126006
SMART Domains Protein: ENSMUSP00000123261
Gene: ENSMUSG00000013936

DomainStartEndE-ValueType
PDB:2W4H|B 2 62 4e-8 PDB
SCOP:d1wdcb_ 10 62 4e-5 SMART
Blast:EFh 37 62 3e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000139213
SMART Domains Protein: ENSMUSP00000114156
Gene: ENSMUSG00000013936

DomainStartEndE-ValueType
Pfam:EF-hand_7 6 54 7e-8 PFAM
Pfam:EF-hand_1 9 37 6.4e-8 PFAM
Pfam:EF-hand_6 9 40 6.2e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146733
SMART Domains Protein: ENSMUSP00000142592
Gene: ENSMUSG00000013936

DomainStartEndE-ValueType
Pfam:EF-hand_7 6 54 1.2e-6 PFAM
Pfam:EF-hand_1 9 37 1.1e-6 PFAM
Pfam:EF-hand_6 9 40 1.1e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147178
Predicted Effect probably benign
Transcript: ENSMUST00000150535
SMART Domains Protein: ENSMUSP00000120274
Gene: ENSMUSG00000013936

DomainStartEndE-ValueType
Pfam:EF-hand_7 6 54 6.2e-8 PFAM
Pfam:EF-hand_1 9 37 5.8e-8 PFAM
Pfam:EF-hand_6 9 40 5.6e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152389
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152744
Predicted Effect probably benign
Transcript: ENSMUST00000153816
SMART Domains Protein: ENSMUSP00000119627
Gene: ENSMUSG00000013936

DomainStartEndE-ValueType
Pfam:EF-hand_1 62 90 2.4e-8 PFAM
Pfam:EF-hand_6 62 91 7.5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155612
SMART Domains Protein: ENSMUSP00000120105
Gene: ENSMUSG00000013936

DomainStartEndE-ValueType
EFh 9 37 2.81e-5 SMART
EFh 79 107 4.53e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198618
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Thus gene encodes the regulatory light chain associated with cardiac myosin beta (or slow) heavy chain. Ca+ triggers the phosphorylation of regulatory light chain that in turn triggers contraction. Mutations in this gene are associated with mid-left ventricular chamber type hypertrophic cardiomyopathy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice heterozygous for a knock-in allele exhibit embryonic growth retardation and die between E12.5 and E14.5 with abnormal heart development characterized by a single ventricle, complete absence of the interventricular groove and septum, and a thin myocardium compact layer. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810408A11Rik T C 11: 69,900,411 Y114C probably damaging Het
4932438A13Rik A T 3: 37,030,025 T3864S probably benign Het
Abcc2 T C 19: 43,811,119 S556P probably damaging Het
AI314180 T C 4: 58,840,751 Y669C probably damaging Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Atp6v1g1 A G 4: 63,550,032 N91D probably benign Het
BC005537 G T 13: 24,803,411 A11S probably benign Het
BC049352 G T 9: 45,244,128 probably null Het
Bub1 A C 2: 127,829,676 probably null Het
Ccdc162 T C 10: 41,561,140 T1758A probably benign Het
Cdh15 T C 8: 122,865,158 L594P probably damaging Het
Cobll1 C T 2: 65,151,073 V90I probably benign Het
Cog2 T C 8: 124,545,136 V463A probably benign Het
Cpeb4 T A 11: 31,927,757 probably null Het
Creb5 G A 6: 53,604,534 M172I possibly damaging Het
Cyp4a32 T C 4: 115,602,929 silent Het
Dnah8 T A 17: 30,662,052 S588T probably benign Het
Esd T C 14: 74,742,077 V120A possibly damaging Het
Fbxo5 T C 10: 5,805,255 probably null Het
Gm4922 T C 10: 18,783,684 D430G probably benign Het
Golga4 C A 9: 118,557,259 Q1150K probably benign Het
Grb14 T C 2: 64,953,603 N60S probably benign Het
Grk4 A G 5: 34,660,981 N2S probably damaging Het
Henmt1 T A 3: 108,942,765 S21R probably benign Het
Ifngr2 A G 16: 91,558,018 K113E probably benign Het
Ighv15-2 T A 12: 114,564,970 T15S probably benign Het
Kif24 A G 4: 41,395,287 S529P probably damaging Het
Large2 T C 2: 92,370,612 N51S possibly damaging Het
Lmtk2 A G 5: 144,174,781 E773G possibly damaging Het
Lrfn3 A T 7: 30,360,042 C253S probably damaging Het
Maea T C 5: 33,360,488 V130A possibly damaging Het
March11 A T 15: 26,311,103 I222F probably damaging Het
Mast4 A T 13: 102,737,258 Y1699* probably null Het
Mavs G T 2: 131,240,450 A85S probably damaging Het
Mpzl3 T A 9: 45,068,231 V160E possibly damaging Het
Myh15 T C 16: 49,065,025 S88P possibly damaging Het
Myo9b A G 8: 71,315,135 N284S probably damaging Het
Nphp1 A G 2: 127,768,169 probably null Het
Nrcam T C 12: 44,562,540 probably null Het
Nt5c3b G T 11: 100,433,059 F134L probably damaging Het
Olfr1225 T A 2: 89,171,200 Q4L probably benign Het
Otog A G 7: 46,287,801 R1645G possibly damaging Het
Pask T C 1: 93,322,108 I523M probably benign Het
Pcdhb7 T A 18: 37,342,135 L108Q probably damaging Het
Pdp2 C A 8: 104,594,944 T475K probably damaging Het
Pgbd1 G C 13: 21,428,329 P113A probably benign Het
Plk5 C T 10: 80,360,467 H291Y possibly damaging Het
Pmpca G T 2: 26,393,335 S382I probably damaging Het
Prl3b1 A G 13: 27,249,467 T202A possibly damaging Het
Ptgs2 A T 1: 150,104,094 T317S possibly damaging Het
Ptprc C T 1: 138,071,251 M1020I probably benign Het
Rhbdl3 T C 11: 80,353,645 Y393H probably damaging Het
Sema3e T C 5: 14,233,703 L482P probably damaging Het
Setd2 C T 9: 110,574,243 T1984I probably benign Het
Slc17a1 T C 13: 23,887,977 Y393H probably damaging Het
Slc9a3 C T 13: 74,158,886 R377* probably null Het
Slitrk3 A G 3: 73,051,206 S78P probably damaging Het
Specc1 T A 11: 62,219,331 V1054E probably damaging Het
Tbc1d4 T C 14: 101,458,783 T847A probably benign Het
Tcf7l2 G A 19: 55,919,036 G343R probably damaging Het
Tex36 A C 7: 133,587,382 Y154D possibly damaging Het
Topaz1 T A 9: 122,747,515 M57K probably null Het
Trav6-4 T C 14: 53,454,699 Y85H probably damaging Het
Trim30d A G 7: 104,472,558 Y327H possibly damaging Het
Ttn A G 2: 76,951,396 V1056A probably benign Het
Usp32 C A 11: 85,059,127 probably null Het
Vmn1r59 A T 7: 5,454,137 M208K probably damaging Het
Vmn2r25 T C 6: 123,823,023 T787A possibly damaging Het
Vps39 A T 2: 120,339,333 I246N probably benign Het
Xab2 T C 8: 3,610,162 D855G probably damaging Het
Xpc A G 6: 91,500,011 S369P probably benign Het
Ythdc2 T A 18: 44,858,198 C758S possibly damaging Het
Zfp62 A G 11: 49,216,272 I397V possibly damaging Het
Zscan4d A G 7: 11,162,508 S312P probably benign Het
Other mutations in Myl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01068:Myl2 APN 5 122106704 missense probably benign
R2879:Myl2 UTSW 5 122104685 critical splice donor site probably null
R5569:Myl2 UTSW 5 122106720 missense possibly damaging 0.95
R5782:Myl2 UTSW 5 122104870 missense probably damaging 1.00
R6493:Myl2 UTSW 5 122106728 missense possibly damaging 0.64
R6560:Myl2 UTSW 5 122102771 missense probably null 1.00
R6878:Myl2 UTSW 5 122105077 missense probably benign
R7163:Myl2 UTSW 5 122101822 missense probably damaging 1.00
R7374:Myl2 UTSW 5 122101663 missense
Predicted Primers PCR Primer
(F):5'- TAACTTTTGGGCCTGCTGAC -3'
(R):5'- GAACCCAAATACTTTGTGACTTTGG -3'

Sequencing Primer
(F):5'- GACAGCAGTCACAGCCTG -3'
(R):5'- CTTTGGCTACTTAGAGCCAAATGAGC -3'
Posted On2015-09-24