Incidental Mutation 'R4580:Pdp2'
ID 343595
Institutional Source Beutler Lab
Gene Symbol Pdp2
Ensembl Gene ENSMUSG00000048371
Gene Name pyruvate dehydrogenase phosphatase catalytic subunit 2
Synonyms LOC382051, 4833426J09Rik
MMRRC Submission 041599-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.116) question?
Stock # R4580 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 105318104-105325658 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 105321576 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 475 (T475K)
Ref Sequence ENSEMBL: ENSMUSP00000092821 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059588]
AlphaFold Q504M2
Predicted Effect probably damaging
Transcript: ENSMUST00000059588
AA Change: T475K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000092821
Gene: ENSMUSG00000048371
AA Change: T475K

DomainStartEndE-ValueType
PP2Cc 96 518 1.1e-92 SMART
PP2C_SIG 121 520 2.56e-1 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a mitochondrial protein that functions as a phosphatase and is involved in the enzymatic resetting of the pyruvate dehydrogenase complex. Alternative splicing results in multiple transcript variants encoding the same protein. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810408A11Rik T C 11: 69,791,237 (GRCm39) Y114C probably damaging Het
Abcc2 T C 19: 43,799,558 (GRCm39) S556P probably damaging Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 117,721,122 (GRCm39) probably benign Het
Atp6v1g1 A G 4: 63,468,269 (GRCm39) N91D probably benign Het
BC005537 G T 13: 24,987,394 (GRCm39) A11S probably benign Het
Bltp1 A T 3: 37,084,174 (GRCm39) T3864S probably benign Het
Bub1 A C 2: 127,671,596 (GRCm39) probably null Het
Ccdc162 T C 10: 41,437,136 (GRCm39) T1758A probably benign Het
Cdh15 T C 8: 123,591,897 (GRCm39) L594P probably damaging Het
Cobll1 C T 2: 64,981,417 (GRCm39) V90I probably benign Het
Cog2 T C 8: 125,271,875 (GRCm39) V463A probably benign Het
Cpeb4 T A 11: 31,877,757 (GRCm39) probably null Het
Creb5 G A 6: 53,581,519 (GRCm39) M172I possibly damaging Het
Cyp4a32 T C 4: 115,460,126 (GRCm39) silent Het
Dnah8 T A 17: 30,881,026 (GRCm39) S588T probably benign Het
Ecpas T C 4: 58,840,751 (GRCm39) Y669C probably damaging Het
Esd T C 14: 74,979,517 (GRCm39) V120A possibly damaging Het
Fbxo5 T C 10: 5,755,255 (GRCm39) probably null Het
Gm4922 T C 10: 18,659,432 (GRCm39) D430G probably benign Het
Golga4 C A 9: 118,386,327 (GRCm39) Q1150K probably benign Het
Grb14 T C 2: 64,783,947 (GRCm39) N60S probably benign Het
Grk4 A G 5: 34,818,325 (GRCm39) N2S probably damaging Het
Henmt1 T A 3: 108,850,081 (GRCm39) S21R probably benign Het
Ifngr2 A G 16: 91,354,906 (GRCm39) K113E probably benign Het
Ighv15-2 T A 12: 114,528,590 (GRCm39) T15S probably benign Het
Kif24 A G 4: 41,395,287 (GRCm39) S529P probably damaging Het
Large2 T C 2: 92,200,957 (GRCm39) N51S possibly damaging Het
Lmtk2 A G 5: 144,111,599 (GRCm39) E773G possibly damaging Het
Lrfn3 A T 7: 30,059,467 (GRCm39) C253S probably damaging Het
Maea T C 5: 33,517,832 (GRCm39) V130A possibly damaging Het
Marchf11 A T 15: 26,311,189 (GRCm39) I222F probably damaging Het
Mast4 A T 13: 102,873,766 (GRCm39) Y1699* probably null Het
Mavs G T 2: 131,082,370 (GRCm39) A85S probably damaging Het
Mpzl3 T A 9: 44,979,529 (GRCm39) V160E possibly damaging Het
Myh15 T C 16: 48,885,388 (GRCm39) S88P possibly damaging Het
Myl2 A T 5: 122,244,801 (GRCm39) H157L probably benign Het
Myo9b A G 8: 71,767,779 (GRCm39) N284S probably damaging Het
Nphp1 A G 2: 127,610,089 (GRCm39) probably null Het
Nrcam T C 12: 44,609,323 (GRCm39) probably null Het
Nt5c3b G T 11: 100,323,885 (GRCm39) F134L probably damaging Het
Or4c120 T A 2: 89,001,544 (GRCm39) Q4L probably benign Het
Otog A G 7: 45,937,225 (GRCm39) R1645G possibly damaging Het
Pask T C 1: 93,249,830 (GRCm39) I523M probably benign Het
Pcdhb7 T A 18: 37,475,188 (GRCm39) L108Q probably damaging Het
Pgbd1 G C 13: 21,612,499 (GRCm39) P113A probably benign Het
Plk5 C T 10: 80,196,301 (GRCm39) H291Y possibly damaging Het
Pmpca G T 2: 26,283,347 (GRCm39) S382I probably damaging Het
Prl3b1 A G 13: 27,433,450 (GRCm39) T202A possibly damaging Het
Ptgs2 A T 1: 149,979,845 (GRCm39) T317S possibly damaging Het
Ptprc C T 1: 137,998,989 (GRCm39) M1020I probably benign Het
Rhbdl3 T C 11: 80,244,471 (GRCm39) Y393H probably damaging Het
Sema3e T C 5: 14,283,717 (GRCm39) L482P probably damaging Het
Setd2 C T 9: 110,403,311 (GRCm39) T1984I probably benign Het
Slc17a1 T C 13: 24,071,960 (GRCm39) Y393H probably damaging Het
Slc9a3 C T 13: 74,307,005 (GRCm39) R377* probably null Het
Slitrk3 A G 3: 72,958,539 (GRCm39) S78P probably damaging Het
Smim35 G T 9: 45,155,426 (GRCm39) probably null Het
Specc1 T A 11: 62,110,157 (GRCm39) V1054E probably damaging Het
Tbc1d4 T C 14: 101,696,219 (GRCm39) T847A probably benign Het
Tcf7l2 G A 19: 55,907,468 (GRCm39) G343R probably damaging Het
Tex36 A C 7: 133,189,111 (GRCm39) Y154D possibly damaging Het
Topaz1 T A 9: 122,576,580 (GRCm39) M57K probably null Het
Trav6-4 T C 14: 53,692,156 (GRCm39) Y85H probably damaging Het
Trim30d A G 7: 104,121,765 (GRCm39) Y327H possibly damaging Het
Ttn A G 2: 76,781,740 (GRCm39) V1056A probably benign Het
Usp32 C A 11: 84,949,953 (GRCm39) probably null Het
Vmn1r59 A T 7: 5,457,136 (GRCm39) M208K probably damaging Het
Vmn2r25 T C 6: 123,799,982 (GRCm39) T787A possibly damaging Het
Vps39 A T 2: 120,169,814 (GRCm39) I246N probably benign Het
Xab2 T C 8: 3,660,162 (GRCm39) D855G probably damaging Het
Xpc A G 6: 91,476,993 (GRCm39) S369P probably benign Het
Ythdc2 T A 18: 44,991,265 (GRCm39) C758S possibly damaging Het
Zfp62 A G 11: 49,107,099 (GRCm39) I397V possibly damaging Het
Zscan4d A G 7: 10,896,435 (GRCm39) S312P probably benign Het
Other mutations in Pdp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00487:Pdp2 APN 8 105,320,829 (GRCm39) missense probably benign
IGL01771:Pdp2 APN 8 105,320,754 (GRCm39) missense probably benign 0.06
IGL01946:Pdp2 APN 8 105,320,824 (GRCm39) missense probably benign 0.00
IGL02313:Pdp2 APN 8 105,321,531 (GRCm39) missense probably benign 0.44
IGL02588:Pdp2 APN 8 105,321,536 (GRCm39) missense possibly damaging 0.73
IGL02981:Pdp2 APN 8 105,320,267 (GRCm39) missense probably benign 0.00
R0456:Pdp2 UTSW 8 105,320,421 (GRCm39) missense probably damaging 1.00
R1260:Pdp2 UTSW 8 105,321,249 (GRCm39) missense probably damaging 0.96
R1974:Pdp2 UTSW 8 105,320,538 (GRCm39) missense probably benign
R3008:Pdp2 UTSW 8 105,320,898 (GRCm39) missense probably benign 0.08
R4655:Pdp2 UTSW 8 105,321,168 (GRCm39) missense probably benign 0.03
R5677:Pdp2 UTSW 8 105,321,320 (GRCm39) missense probably damaging 1.00
R6813:Pdp2 UTSW 8 105,321,131 (GRCm39) missense probably damaging 1.00
R8176:Pdp2 UTSW 8 105,321,687 (GRCm39) missense probably damaging 1.00
R8472:Pdp2 UTSW 8 105,320,913 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTAAGGCGCCAGGATAAGTTCC -3'
(R):5'- ATTCCTGTTAGCCTTGGCAC -3'

Sequencing Primer
(F):5'- ATAAGTTCCTGGTGCTGGCCTC -3'
(R):5'- TGTTAGCCTTGGCACCAGAG -3'
Posted On 2015-09-24