Incidental Mutation 'R4580:Cog2'
ID343597
Institutional Source Beutler Lab
Gene Symbol Cog2
Ensembl Gene ENSMUSG00000031979
Gene Namecomponent of oligomeric golgi complex 2
Synonyms2700012E02Rik, 1190002B08Rik, Cog2
MMRRC Submission 041599-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4580 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location124520767-124552008 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 124545136 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 463 (V463A)
Ref Sequence ENSEMBL: ENSMUSP00000034460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034460]
Predicted Effect probably benign
Transcript: ENSMUST00000034460
AA Change: V463A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000034460
Gene: ENSMUSG00000031979
AA Change: V463A

DomainStartEndE-ValueType
Pfam:COG2 15 147 1.4e-44 PFAM
low complexity region 207 220 N/A INTRINSIC
low complexity region 490 502 N/A INTRINSIC
Pfam:DUF3510 565 692 6.1e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000108803
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129977
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the conserved oligomeric Golgi complex that is required for maintaining normal structure and activity of the Golgi complex. The encoded protein specifically interacts with the USO1 vesicle docking protein and may be necessary for normal Golgi ribbon formation and trafficking of Golgi enzymes. Mutations of this gene are associated with abnormal glycosylation within the Golgi apparatus. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810408A11Rik T C 11: 69,900,411 Y114C probably damaging Het
4932438A13Rik A T 3: 37,030,025 T3864S probably benign Het
Abcc2 T C 19: 43,811,119 S556P probably damaging Het
AI314180 T C 4: 58,840,751 Y669C probably damaging Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Atp6v1g1 A G 4: 63,550,032 N91D probably benign Het
BC005537 G T 13: 24,803,411 A11S probably benign Het
BC049352 G T 9: 45,244,128 probably null Het
Bub1 A C 2: 127,829,676 probably null Het
Ccdc162 T C 10: 41,561,140 T1758A probably benign Het
Cdh15 T C 8: 122,865,158 L594P probably damaging Het
Cobll1 C T 2: 65,151,073 V90I probably benign Het
Cpeb4 T A 11: 31,927,757 probably null Het
Creb5 G A 6: 53,604,534 M172I possibly damaging Het
Cyp4a32 T C 4: 115,602,929 silent Het
Dnah8 T A 17: 30,662,052 S588T probably benign Het
Esd T C 14: 74,742,077 V120A possibly damaging Het
Fbxo5 T C 10: 5,805,255 probably null Het
Gm4922 T C 10: 18,783,684 D430G probably benign Het
Golga4 C A 9: 118,557,259 Q1150K probably benign Het
Grb14 T C 2: 64,953,603 N60S probably benign Het
Grk4 A G 5: 34,660,981 N2S probably damaging Het
Henmt1 T A 3: 108,942,765 S21R probably benign Het
Ifngr2 A G 16: 91,558,018 K113E probably benign Het
Ighv15-2 T A 12: 114,564,970 T15S probably benign Het
Kif24 A G 4: 41,395,287 S529P probably damaging Het
Large2 T C 2: 92,370,612 N51S possibly damaging Het
Lmtk2 A G 5: 144,174,781 E773G possibly damaging Het
Lrfn3 A T 7: 30,360,042 C253S probably damaging Het
Maea T C 5: 33,360,488 V130A possibly damaging Het
March11 A T 15: 26,311,103 I222F probably damaging Het
Mast4 A T 13: 102,737,258 Y1699* probably null Het
Mavs G T 2: 131,240,450 A85S probably damaging Het
Mpzl3 T A 9: 45,068,231 V160E possibly damaging Het
Myh15 T C 16: 49,065,025 S88P possibly damaging Het
Myl2 A T 5: 122,106,738 H157L probably benign Het
Myo9b A G 8: 71,315,135 N284S probably damaging Het
Nphp1 A G 2: 127,768,169 probably null Het
Nrcam T C 12: 44,562,540 probably null Het
Nt5c3b G T 11: 100,433,059 F134L probably damaging Het
Olfr1225 T A 2: 89,171,200 Q4L probably benign Het
Otog A G 7: 46,287,801 R1645G possibly damaging Het
Pask T C 1: 93,322,108 I523M probably benign Het
Pcdhb7 T A 18: 37,342,135 L108Q probably damaging Het
Pdp2 C A 8: 104,594,944 T475K probably damaging Het
Pgbd1 G C 13: 21,428,329 P113A probably benign Het
Plk5 C T 10: 80,360,467 H291Y possibly damaging Het
Pmpca G T 2: 26,393,335 S382I probably damaging Het
Prl3b1 A G 13: 27,249,467 T202A possibly damaging Het
Ptgs2 A T 1: 150,104,094 T317S possibly damaging Het
Ptprc C T 1: 138,071,251 M1020I probably benign Het
Rhbdl3 T C 11: 80,353,645 Y393H probably damaging Het
Sema3e T C 5: 14,233,703 L482P probably damaging Het
Setd2 C T 9: 110,574,243 T1984I probably benign Het
Slc17a1 T C 13: 23,887,977 Y393H probably damaging Het
Slc9a3 C T 13: 74,158,886 R377* probably null Het
Slitrk3 A G 3: 73,051,206 S78P probably damaging Het
Specc1 T A 11: 62,219,331 V1054E probably damaging Het
Tbc1d4 T C 14: 101,458,783 T847A probably benign Het
Tcf7l2 G A 19: 55,919,036 G343R probably damaging Het
Tex36 A C 7: 133,587,382 Y154D possibly damaging Het
Topaz1 T A 9: 122,747,515 M57K probably null Het
Trav6-4 T C 14: 53,454,699 Y85H probably damaging Het
Trim30d A G 7: 104,472,558 Y327H possibly damaging Het
Ttn A G 2: 76,951,396 V1056A probably benign Het
Usp32 C A 11: 85,059,127 probably null Het
Vmn1r59 A T 7: 5,454,137 M208K probably damaging Het
Vmn2r25 T C 6: 123,823,023 T787A possibly damaging Het
Vps39 A T 2: 120,339,333 I246N probably benign Het
Xab2 T C 8: 3,610,162 D855G probably damaging Het
Xpc A G 6: 91,500,011 S369P probably benign Het
Ythdc2 T A 18: 44,858,198 C758S possibly damaging Het
Zfp62 A G 11: 49,216,272 I397V possibly damaging Het
Zscan4d A G 7: 11,162,508 S312P probably benign Het
Other mutations in Cog2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01089:Cog2 APN 8 124545243 missense probably benign 0.00
IGL01092:Cog2 APN 8 124545280 missense probably damaging 1.00
IGL01150:Cog2 APN 8 124542891 missense possibly damaging 0.62
IGL02052:Cog2 APN 8 124542888 critical splice acceptor site probably null
IGL02308:Cog2 APN 8 124533212 critical splice acceptor site probably null
IGL02543:Cog2 APN 8 124529959 missense probably benign 0.09
IGL02978:Cog2 APN 8 124550336 missense probably benign
IGL03008:Cog2 APN 8 124535392 splice site probably benign
IGL03144:Cog2 APN 8 124541024 missense probably damaging 0.98
kugge UTSW 8 124550232 missense probably damaging 1.00
Pelota UTSW 8 124550306 missense probably damaging 1.00
PIT4677001:Cog2 UTSW 8 124545271 missense probably benign 0.22
R0071:Cog2 UTSW 8 124548668 splice site probably benign
R0071:Cog2 UTSW 8 124548668 splice site probably benign
R0110:Cog2 UTSW 8 124529058 critical splice donor site probably null
R0436:Cog2 UTSW 8 124548514 splice site probably benign
R0450:Cog2 UTSW 8 124529058 critical splice donor site probably null
R1365:Cog2 UTSW 8 124540974 missense probably damaging 0.97
R1661:Cog2 UTSW 8 124542890 missense probably benign 0.20
R1698:Cog2 UTSW 8 124525683 missense probably damaging 1.00
R1856:Cog2 UTSW 8 124551403 missense possibly damaging 0.93
R2122:Cog2 UTSW 8 124528985 missense possibly damaging 0.91
R2398:Cog2 UTSW 8 124529926 missense probably benign 0.07
R3855:Cog2 UTSW 8 124530003 critical splice donor site probably null
R4803:Cog2 UTSW 8 124535451 missense probably damaging 0.96
R5316:Cog2 UTSW 8 124529040 missense probably benign 0.14
R5346:Cog2 UTSW 8 124546631 missense possibly damaging 0.94
R5394:Cog2 UTSW 8 124532529 missense probably benign 0.00
R5395:Cog2 UTSW 8 124545221 missense probably benign 0.00
R5738:Cog2 UTSW 8 124546038 missense probably benign 0.03
R5861:Cog2 UTSW 8 124537878 missense probably damaging 1.00
R5894:Cog2 UTSW 8 124545267 missense probably benign 0.00
R5941:Cog2 UTSW 8 124546086 missense probably benign
R6186:Cog2 UTSW 8 124546686 missense probably damaging 1.00
R6400:Cog2 UTSW 8 124550306 missense probably damaging 1.00
R6518:Cog2 UTSW 8 124527103 nonsense probably null
R6558:Cog2 UTSW 8 124550232 missense probably damaging 1.00
R6717:Cog2 UTSW 8 124525749 missense probably damaging 1.00
R6902:Cog2 UTSW 8 124546691 missense probably damaging 1.00
R6914:Cog2 UTSW 8 124545136 missense probably benign 0.00
R6942:Cog2 UTSW 8 124545136 missense probably benign 0.00
R7103:Cog2 UTSW 8 124541114 critical splice donor site probably null
R7274:Cog2 UTSW 8 124535519 missense possibly damaging 0.71
R7641:Cog2 UTSW 8 124537882 missense probably damaging 0.96
R7674:Cog2 UTSW 8 124537882 missense probably damaging 0.96
X0026:Cog2 UTSW 8 124546020 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- ATACCTGTGAGCTGAGGTGC -3'
(R):5'- AAGCTCACCCATTCCTGCAG -3'

Sequencing Primer
(F):5'- GCTCCCAGACTTCCTCAGG -3'
(R):5'- ATTCCTGCAGCCTGCCCAG -3'
Posted On2015-09-24