Mutagenetix > Incidental Mutation

Incidental Mutation 'R4580:Cog2'

343597

Institutional Source

Beutler Lab

Gene Symbol

Cog2

Ensembl Gene

ENSMUSG00000031979

Gene Name

component of oligomeric golgi complex 2

Synonyms

2700012E02Rik, 1190002B08Rik, Cog2

MMRRC Submission

041599-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4580 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

124520767-124552008 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 124545136 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 463 (V463A)

Ref Sequence

ENSEMBL: ENSMUSP00000034460 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034460]

AlphaFold

Q921L5

Predicted Effect

probably benign
Transcript: ENSMUST00000034460
AA Change: V463A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000034460
Gene: ENSMUSG00000031979
AA Change: V463A

Domain	Start	End	E-Value	Type
Pfam:COG2	15	147	1.4e-44	PFAM
low complexity region	207	220	N/A	INTRINSIC
low complexity region	490	502	N/A	INTRINSIC
Pfam:DUF3510	565	692	6.1e-45	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000108803

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129977

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.1%
20x: 94.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the conserved oligomeric Golgi complex that is required for maintaining normal structure and activity of the Golgi complex. The encoded protein specifically interacts with the USO1 vesicle docking protein and may be necessary for normal Golgi ribbon formation and trafficking of Golgi enzymes. Mutations of this gene are associated with abnormal glycosylation within the Golgi apparatus. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Feb 2009]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810408A11Rik	T	C	11: 69,900,411	Y114C	probably damaging	Het
4932438A13Rik	A	T	3: 37,030,025	T3864S	probably benign	Het
Abcc2	T	C	19: 43,811,119	S556P	probably damaging	Het
AI314180	T	C	4: 58,840,751	Y669C	probably damaging	Het
Arl6ip1	AAAATAAATAAATAAATAAATAAATA	AAAATAAATAAATAAATAAATAAATAAATA	7: 118,121,899		probably benign	Het
Atp6v1g1	A	G	4: 63,550,032	N91D	probably benign	Het
BC005537	G	T	13: 24,803,411	A11S	probably benign	Het
BC049352	G	T	9: 45,244,128		probably null	Het
Bub1	A	C	2: 127,829,676		probably null	Het
Ccdc162	T	C	10: 41,561,140	T1758A	probably benign	Het
Cdh15	T	C	8: 122,865,158	L594P	probably damaging	Het
Cobll1	C	T	2: 65,151,073	V90I	probably benign	Het
Cpeb4	T	A	11: 31,927,757		probably null	Het
Creb5	G	A	6: 53,604,534	M172I	possibly damaging	Het
Cyp4a32	T	C	4: 115,602,929		silent	Het
Dnah8	T	A	17: 30,662,052	S588T	probably benign	Het
Esd	T	C	14: 74,742,077	V120A	possibly damaging	Het
Fbxo5	T	C	10: 5,805,255		probably null	Het
Gm4922	T	C	10: 18,783,684	D430G	probably benign	Het
Golga4	C	A	9: 118,557,259	Q1150K	probably benign	Het
Grb14	T	C	2: 64,953,603	N60S	probably benign	Het
Grk4	A	G	5: 34,660,981	N2S	probably damaging	Het
Henmt1	T	A	3: 108,942,765	S21R	probably benign	Het
Ifngr2	A	G	16: 91,558,018	K113E	probably benign	Het
Ighv15-2	T	A	12: 114,564,970	T15S	probably benign	Het
Kif24	A	G	4: 41,395,287	S529P	probably damaging	Het
Large2	T	C	2: 92,370,612	N51S	possibly damaging	Het
Lmtk2	A	G	5: 144,174,781	E773G	possibly damaging	Het
Lrfn3	A	T	7: 30,360,042	C253S	probably damaging	Het
Maea	T	C	5: 33,360,488	V130A	possibly damaging	Het
March11	A	T	15: 26,311,103	I222F	probably damaging	Het
Mast4	A	T	13: 102,737,258	Y1699*	probably null	Het
Mavs	G	T	2: 131,240,450	A85S	probably damaging	Het
Mpzl3	T	A	9: 45,068,231	V160E	possibly damaging	Het
Myh15	T	C	16: 49,065,025	S88P	possibly damaging	Het
Myl2	A	T	5: 122,106,738	H157L	probably benign	Het
Myo9b	A	G	8: 71,315,135	N284S	probably damaging	Het
Nphp1	A	G	2: 127,768,169		probably null	Het
Nrcam	T	C	12: 44,562,540		probably null	Het
Nt5c3b	G	T	11: 100,433,059	F134L	probably damaging	Het
Olfr1225	T	A	2: 89,171,200	Q4L	probably benign	Het
Otog	A	G	7: 46,287,801	R1645G	possibly damaging	Het
Pask	T	C	1: 93,322,108	I523M	probably benign	Het
Pcdhb7	T	A	18: 37,342,135	L108Q	probably damaging	Het
Pdp2	C	A	8: 104,594,944	T475K	probably damaging	Het
Pgbd1	G	C	13: 21,428,329	P113A	probably benign	Het
Plk5	C	T	10: 80,360,467	H291Y	possibly damaging	Het
Pmpca	G	T	2: 26,393,335	S382I	probably damaging	Het
Prl3b1	A	G	13: 27,249,467	T202A	possibly damaging	Het
Ptgs2	A	T	1: 150,104,094	T317S	possibly damaging	Het
Ptprc	C	T	1: 138,071,251	M1020I	probably benign	Het
Rhbdl3	T	C	11: 80,353,645	Y393H	probably damaging	Het
Sema3e	T	C	5: 14,233,703	L482P	probably damaging	Het
Setd2	C	T	9: 110,574,243	T1984I	probably benign	Het
Slc17a1	T	C	13: 23,887,977	Y393H	probably damaging	Het
Slc9a3	C	T	13: 74,158,886	R377*	probably null	Het
Slitrk3	A	G	3: 73,051,206	S78P	probably damaging	Het
Specc1	T	A	11: 62,219,331	V1054E	probably damaging	Het
Tbc1d4	T	C	14: 101,458,783	T847A	probably benign	Het
Tcf7l2	G	A	19: 55,919,036	G343R	probably damaging	Het
Tex36	A	C	7: 133,587,382	Y154D	possibly damaging	Het
Topaz1	T	A	9: 122,747,515	M57K	probably null	Het
Trav6-4	T	C	14: 53,454,699	Y85H	probably damaging	Het
Trim30d	A	G	7: 104,472,558	Y327H	possibly damaging	Het
Ttn	A	G	2: 76,951,396	V1056A	probably benign	Het
Usp32	C	A	11: 85,059,127		probably null	Het
Vmn1r59	A	T	7: 5,454,137	M208K	probably damaging	Het
Vmn2r25	T	C	6: 123,823,023	T787A	possibly damaging	Het
Vps39	A	T	2: 120,339,333	I246N	probably benign	Het
Xab2	T	C	8: 3,610,162	D855G	probably damaging	Het
Xpc	A	G	6: 91,500,011	S369P	probably benign	Het
Ythdc2	T	A	18: 44,858,198	C758S	possibly damaging	Het
Zfp62	A	G	11: 49,216,272	I397V	possibly damaging	Het
Zscan4d	A	G	7: 11,162,508	S312P	probably benign	Het

Other mutations in Cog2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01089:Cog2	APN	8	124545243	missense	probably benign	0.00
IGL01092:Cog2	APN	8	124545280	missense	probably damaging	1.00
IGL01150:Cog2	APN	8	124542891	missense	possibly damaging	0.62
IGL02052:Cog2	APN	8	124542888	critical splice acceptor site	probably null
IGL02308:Cog2	APN	8	124533212	critical splice acceptor site	probably null
IGL02543:Cog2	APN	8	124529959	missense	probably benign	0.09
IGL02978:Cog2	APN	8	124550336	missense	probably benign
IGL03008:Cog2	APN	8	124535392	splice site	probably benign
IGL03144:Cog2	APN	8	124541024	missense	probably damaging	0.98
kugge	UTSW	8	124550232	missense	probably damaging	1.00
Pelota	UTSW	8	124550306	missense	probably damaging	1.00
PIT4677001:Cog2	UTSW	8	124545271	missense	probably benign	0.22
R0071:Cog2	UTSW	8	124548668	splice site	probably benign
R0071:Cog2	UTSW	8	124548668	splice site	probably benign
R0110:Cog2	UTSW	8	124529058	critical splice donor site	probably null
R0436:Cog2	UTSW	8	124548514	splice site	probably benign
R0450:Cog2	UTSW	8	124529058	critical splice donor site	probably null
R1365:Cog2	UTSW	8	124540974	missense	probably damaging	0.97
R1661:Cog2	UTSW	8	124542890	missense	probably benign	0.20
R1698:Cog2	UTSW	8	124525683	missense	probably damaging	1.00
R1856:Cog2	UTSW	8	124551403	missense	possibly damaging	0.93
R2122:Cog2	UTSW	8	124528985	missense	possibly damaging	0.91
R2398:Cog2	UTSW	8	124529926	missense	probably benign	0.07
R3855:Cog2	UTSW	8	124530003	critical splice donor site	probably null
R4803:Cog2	UTSW	8	124535451	missense	probably damaging	0.96
R5316:Cog2	UTSW	8	124529040	missense	probably benign	0.14
R5346:Cog2	UTSW	8	124546631	missense	possibly damaging	0.94
R5394:Cog2	UTSW	8	124532529	missense	probably benign	0.00
R5395:Cog2	UTSW	8	124545221	missense	probably benign	0.00
R5738:Cog2	UTSW	8	124546038	missense	probably benign	0.03
R5861:Cog2	UTSW	8	124537878	missense	probably damaging	1.00
R5894:Cog2	UTSW	8	124545267	missense	probably benign	0.00
R5941:Cog2	UTSW	8	124546086	missense	probably benign
R6186:Cog2	UTSW	8	124546686	missense	probably damaging	1.00
R6400:Cog2	UTSW	8	124550306	missense	probably damaging	1.00
R6518:Cog2	UTSW	8	124527103	nonsense	probably null
R6558:Cog2	UTSW	8	124550232	missense	probably damaging	1.00
R6717:Cog2	UTSW	8	124525749	missense	probably damaging	1.00
R6902:Cog2	UTSW	8	124546691	missense	probably damaging	1.00
R6914:Cog2	UTSW	8	124545136	missense	probably benign	0.00
R6942:Cog2	UTSW	8	124545136	missense	probably benign	0.00
R7103:Cog2	UTSW	8	124541114	critical splice donor site	probably null
R7274:Cog2	UTSW	8	124535519	missense	possibly damaging	0.71
R7641:Cog2	UTSW	8	124537882	missense	probably damaging	0.96
R7674:Cog2	UTSW	8	124537882	missense	probably damaging	0.96
R8559:Cog2	UTSW	8	124542908	missense	probably benign	0.25
R9190:Cog2	UTSW	8	124533319	missense	probably damaging	1.00
R9307:Cog2	UTSW	8	124527098	critical splice acceptor site	probably null
R9629:Cog2	UTSW	8	124533386	missense	possibly damaging	0.67
X0026:Cog2	UTSW	8	124546020	missense	possibly damaging	0.88

Predicted Primers

PCR Primer
(F):5'- ATACCTGTGAGCTGAGGTGC -3'
(R):5'- AAGCTCACCCATTCCTGCAG -3'

Sequencing Primer
(F):5'- GCTCCCAGACTTCCTCAGG -3'
(R):5'- ATTCCTGCAGCCTGCCCAG -3'

Posted On

2015-09-24