Incidental Mutation 'R0058:Tspear'
ID34360
Institutional Source Beutler Lab
Gene Symbol Tspear
Ensembl Gene ENSMUSG00000069581
Gene Namethrombospondin type laminin G domain and EAR repeats
SynonymsC330046G03Rik, ORF65
MMRRC Submission 038352-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R0058 (G1)
Quality Score136
Status Validated
Chromosome10
Chromosomal Location77686569-77887021 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 77869631 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 288 (F288L)
Ref Sequence ENSEMBL: ENSMUSP00000090020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092366]
Predicted Effect probably benign
Transcript: ENSMUST00000092366
AA Change: F288L

PolyPhen 2 Score 0.069 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000090020
Gene: ENSMUSG00000069581
AA Change: F288L

DomainStartEndE-ValueType
Blast:TSPN 1 71 8e-40 BLAST
SCOP:d1c4ra_ 2 67 2e-7 SMART
low complexity region 190 200 N/A INTRINSIC
Pfam:EPTP 208 255 2.6e-22 PFAM
Pfam:EPTP 260 307 1.4e-21 PFAM
Pfam:EPTP 312 359 8.9e-14 PFAM
Pfam:EPTP 362 417 6.2e-13 PFAM
Pfam:EPTP 422 469 1.3e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000092368
SMART Domains Protein: ENSMUSP00000090022
Gene: ENSMUSG00000069581

DomainStartEndE-ValueType
TSPN 3 174 2.24e-5 SMART
LamG 34 173 1.09e-1 SMART
low complexity region 293 303 N/A INTRINSIC
Pfam:EPTP 311 357 3.4e-20 PFAM
Pfam:EPTP 362 409 4.9e-23 PFAM
Pfam:EPTP 414 461 3.1e-15 PFAM
Pfam:EPTP 464 519 2.2e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125241
Meta Mutation Damage Score 0.1355 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains a N-terminal thrombospondin-type laminin G domain and several tandem arranged epilepsy-associated repeats (EARs). A mutation in this gene is the cause of autosomal recessive deafness-98. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ache T G 5: 137,290,842 V270G probably damaging Het
Acss1 A T 2: 150,628,539 W394R probably damaging Het
Adgrv1 A G 13: 81,182,672 V6088A possibly damaging Het
Ankrd36 A G 11: 5,630,691 probably benign Het
Anxa1 A T 19: 20,383,777 Y84N probably damaging Het
Arnt2 G A 7: 84,347,530 R63C probably damaging Het
Avpr1b A G 1: 131,599,786 T16A probably benign Het
Bpifb1 G A 2: 154,206,540 R165H possibly damaging Het
Cables1 A G 18: 11,923,413 E316G possibly damaging Het
Cadm1 A T 9: 47,850,331 I427L probably damaging Het
Ccdc97 T C 7: 25,715,980 D86G probably benign Het
Cgnl1 C A 9: 71,641,397 D1081Y probably damaging Het
Cgnl1 T A 9: 71,724,840 R410W probably damaging Het
Cntnap4 G A 8: 112,785,784 E593K probably damaging Het
Dazap1 T C 10: 80,261,581 probably benign Het
Dip2b A G 15: 100,215,240 E1512G probably benign Het
Dock1 G A 7: 135,108,761 V1171M possibly damaging Het
Dock5 A T 14: 67,781,036 F1230Y probably benign Het
Dym G A 18: 75,043,172 E15K possibly damaging Het
Ednra C A 8: 77,667,322 probably null Het
Faf1 A G 4: 109,736,624 Q133R probably benign Het
Fbxw28 A G 9: 109,328,211 I323T probably benign Het
Fcer2a T C 8: 3,688,111 probably benign Het
Fmo2 A T 1: 162,886,324 S204R probably benign Het
Frmd4b A G 6: 97,423,499 V63A probably damaging Het
Fzd8 G A 18: 9,213,985 A356T possibly damaging Het
Ghitm A G 14: 37,131,592 L97P probably damaging Het
Gins4 A G 8: 23,229,510 probably benign Het
Golga3 T A 5: 110,202,777 F766Y possibly damaging Het
Hapln1 T C 13: 89,607,878 I267T probably benign Het
Helz A T 11: 107,672,558 probably benign Het
Herc2 T C 7: 56,170,483 V2851A possibly damaging Het
Igkv8-18 G A 6: 70,356,121 probably benign Het
Igll1 A T 16: 16,863,876 V5E probably benign Het
Irx3 T C 8: 91,800,540 T179A possibly damaging Het
Kif16b A G 2: 142,857,305 probably null Het
Limk1 A T 5: 134,659,871 W507R probably damaging Het
Marf1 C T 16: 14,142,534 A549T probably damaging Het
Mtif3 C A 5: 146,956,921 V159F probably benign Het
Myh6 C T 14: 54,963,404 R169Q probably damaging Het
Ncoa7 T A 10: 30,647,541 D887V probably damaging Het
Obox7 C T 7: 14,664,388 P76S probably benign Het
Olfr1335 A G 4: 118,809,480 M128T probably benign Het
Olfr323 A T 11: 58,625,668 I126N probably damaging Het
Pitpnm2 G A 5: 124,124,030 A862V probably damaging Het
Pkd1 G C 17: 24,564,703 A162P probably benign Het
Plce1 A G 19: 38,525,184 D309G possibly damaging Het
Plk4 T C 3: 40,805,872 V401A probably benign Het
Prdx3 T C 19: 60,874,512 probably benign Het
Prrc2c C T 1: 162,698,884 V253I unknown Het
Ranbp2 T A 10: 58,480,531 S2358T probably damaging Het
Setd2 T A 9: 110,594,426 V2183E probably damaging Het
Sgsm1 T A 5: 113,285,087 S232C probably damaging Het
Skint6 A T 4: 113,046,815 probably benign Het
Slc15a2 A G 16: 36,754,547 I531T probably benign Het
Slc36a1 C T 11: 55,221,994 probably benign Het
Sorbs2 T A 8: 45,785,254 probably null Het
Sorbs2 C A 8: 45,796,263 D831E probably damaging Het
Sptan1 T C 2: 29,993,696 probably null Het
Stam T C 2: 14,138,141 C336R probably damaging Het
Stil G T 4: 115,041,298 A1042S probably damaging Het
Stxbp5l T A 16: 37,142,374 D773V possibly damaging Het
Sugct A T 13: 17,672,581 L39Q probably damaging Het
Tep1 A G 14: 50,834,065 V2041A possibly damaging Het
Tex15 C T 8: 33,581,502 probably benign Het
Tlr9 T G 9: 106,224,965 L485R possibly damaging Het
Tmem207 A G 16: 26,524,829 probably benign Het
Triml2 T C 8: 43,185,269 probably benign Het
Trip6 A G 5: 137,310,845 probably benign Het
Vmn1r179 C T 7: 23,929,167 T261I possibly damaging Het
Zfp644 A T 5: 106,637,003 S559R possibly damaging Het
Other mutations in Tspear
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Tspear APN 10 77873236 missense probably benign 0.30
IGL01726:Tspear APN 10 77881287 intron probably benign
IGL02244:Tspear APN 10 77852856 unclassified probably benign
IGL02393:Tspear APN 10 77836573 missense probably damaging 1.00
IGL02502:Tspear APN 10 77852958 intron probably benign
IGL02653:Tspear APN 10 77706965 utr 3 prime probably benign
IGL03345:Tspear APN 10 77874882 splice site probably null
R0058:Tspear UTSW 10 77869631 missense probably benign 0.07
R0542:Tspear UTSW 10 77881087 missense probably benign 0.14
R1384:Tspear UTSW 10 77866332 missense probably benign 0.44
R1467:Tspear UTSW 10 77881192 missense probably damaging 1.00
R1467:Tspear UTSW 10 77881192 missense probably damaging 1.00
R1545:Tspear UTSW 10 77870419 missense possibly damaging 0.48
R1625:Tspear UTSW 10 77870499 missense probably benign 0.20
R1635:Tspear UTSW 10 77870419 missense possibly damaging 0.48
R1636:Tspear UTSW 10 77870419 missense possibly damaging 0.48
R1637:Tspear UTSW 10 77870419 missense possibly damaging 0.48
R1744:Tspear UTSW 10 77864884 unclassified probably null
R1749:Tspear UTSW 10 77869673 missense probably benign 0.00
R1768:Tspear UTSW 10 77875116 critical splice donor site probably null
R1774:Tspear UTSW 10 77873185 missense probably benign 0.01
R1791:Tspear UTSW 10 77870419 missense possibly damaging 0.48
R1892:Tspear UTSW 10 77870474 missense probably benign 0.00
R2014:Tspear UTSW 10 77875120 splice site probably benign
R2108:Tspear UTSW 10 77870419 missense possibly damaging 0.48
R2248:Tspear UTSW 10 77873269 missense probably damaging 1.00
R3038:Tspear UTSW 10 77886439 nonsense probably null
R4010:Tspear UTSW 10 77836476 intron probably benign
R4661:Tspear UTSW 10 77866329 missense probably benign 0.24
R4734:Tspear UTSW 10 77864695 missense probably damaging 0.99
R4789:Tspear UTSW 10 77866365 missense possibly damaging 0.63
R4804:Tspear UTSW 10 77776957 unclassified probably null
R4904:Tspear UTSW 10 77869655 missense possibly damaging 0.93
R4937:Tspear UTSW 10 77875043 missense probably damaging 0.98
R4956:Tspear UTSW 10 77864767 missense possibly damaging 0.86
R5590:Tspear UTSW 10 77870365 missense probably benign
R6344:Tspear UTSW 10 77875013 missense possibly damaging 0.95
R6629:Tspear UTSW 10 77870509 missense probably benign 0.08
R7611:Tspear UTSW 10 77881215 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAGGACCATTGGGGCTTAGACACC -3'
(R):5'- GGAGAAAACATCCTGGCTTGCCTG -3'

Sequencing Primer
(F):5'- GGGCTTAGACACCTTGCATAG -3'
(R):5'- ACCTGCTACTGAAGTGGCTC -3'
Posted On2013-05-09