Mutagenetix > Incidental Mutation

Incidental Mutation 'R0058:Tspear'

34360

Institutional Source

Beutler Lab

Gene Symbol

Tspear

Ensembl Gene

ENSMUSG00000069581

Gene Name

thrombospondin type laminin G domain and EAR repeats

Synonyms

C330046G03Rik, ORF65

MMRRC Submission

038352-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.056) question?

Stock #

R0058 (G1)

Quality Score

136

Status

Validated

Chromosome

Chromosomal Location

77686569-77887021 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 77869631 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 288 (F288L)

Ref Sequence

ENSEMBL: ENSMUSP00000090020 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000092366]

AlphaFold

J3S6Y1

Predicted Effect

probably benign
Transcript: ENSMUST00000092366
AA Change: F288L

PolyPhen 2 Score 0.069 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000090020
Gene: ENSMUSG00000069581
AA Change: F288L

Domain	Start	End	E-Value	Type
Blast:TSPN	1	71	8e-40	BLAST
SCOP:d1c4ra_	2	67	2e-7	SMART
low complexity region	190	200	N/A	INTRINSIC
Pfam:EPTP	208	255	2.6e-22	PFAM
Pfam:EPTP	260	307	1.4e-21	PFAM
Pfam:EPTP	312	359	8.9e-14	PFAM
Pfam:EPTP	362	417	6.2e-13	PFAM
Pfam:EPTP	422	469	1.3e-20	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000092368

SMART Domains

Protein: ENSMUSP00000090022
Gene: ENSMUSG00000069581

Domain	Start	End	E-Value	Type
TSPN	3	174	2.24e-5	SMART
LamG	34	173	1.09e-1	SMART
low complexity region	293	303	N/A	INTRINSIC
Pfam:EPTP	311	357	3.4e-20	PFAM
Pfam:EPTP	362	409	4.9e-23	PFAM
Pfam:EPTP	414	461	3.1e-15	PFAM
Pfam:EPTP	464	519	2.2e-14	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125241

Meta Mutation Damage Score

0.1355

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.0%
20x: 94.8%

Validation Efficiency

100% (74/74)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains a N-terminal thrombospondin-type laminin G domain and several tandem arranged epilepsy-associated repeats (EARs). A mutation in this gene is the cause of autosomal recessive deafness-98. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ache	T	G	5: 137,290,842	V270G	probably damaging	Het
Acss1	A	T	2: 150,628,539	W394R	probably damaging	Het
Adgrv1	A	G	13: 81,182,672	V6088A	possibly damaging	Het
Ankrd36	A	G	11: 5,630,691		probably benign	Het
Anxa1	A	T	19: 20,383,777	Y84N	probably damaging	Het
Arnt2	G	A	7: 84,347,530	R63C	probably damaging	Het
Avpr1b	A	G	1: 131,599,786	T16A	probably benign	Het
Bpifb1	G	A	2: 154,206,540	R165H	possibly damaging	Het
Cables1	A	G	18: 11,923,413	E316G	possibly damaging	Het
Cadm1	A	T	9: 47,850,331	I427L	probably damaging	Het
Ccdc97	T	C	7: 25,715,980	D86G	probably benign	Het
Cgnl1	C	A	9: 71,641,397	D1081Y	probably damaging	Het
Cgnl1	T	A	9: 71,724,840	R410W	probably damaging	Het
Cntnap4	G	A	8: 112,785,784	E593K	probably damaging	Het
Dazap1	T	C	10: 80,261,581		probably benign	Het
Dip2b	A	G	15: 100,215,240	E1512G	probably benign	Het
Dock1	G	A	7: 135,108,761	V1171M	possibly damaging	Het
Dock5	A	T	14: 67,781,036	F1230Y	probably benign	Het
Dym	G	A	18: 75,043,172	E15K	possibly damaging	Het
Ednra	C	A	8: 77,667,322		probably null	Het
Faf1	A	G	4: 109,736,624	Q133R	probably benign	Het
Fbxw28	A	G	9: 109,328,211	I323T	probably benign	Het
Fcer2a	T	C	8: 3,688,111		probably benign	Het
Fmo2	A	T	1: 162,886,324	S204R	probably benign	Het
Frmd4b	A	G	6: 97,423,499	V63A	probably damaging	Het
Fzd8	G	A	18: 9,213,985	A356T	possibly damaging	Het
Ghitm	A	G	14: 37,131,592	L97P	probably damaging	Het
Gins4	A	G	8: 23,229,510		probably benign	Het
Golga3	T	A	5: 110,202,777	F766Y	possibly damaging	Het
Hapln1	T	C	13: 89,607,878	I267T	probably benign	Het
Helz	A	T	11: 107,672,558		probably benign	Het
Herc2	T	C	7: 56,170,483	V2851A	possibly damaging	Het
Igkv8-18	G	A	6: 70,356,121		probably benign	Het
Igll1	A	T	16: 16,863,876	V5E	probably benign	Het
Irx3	T	C	8: 91,800,540	T179A	possibly damaging	Het
Kif16b	A	G	2: 142,857,305		probably null	Het
Limk1	A	T	5: 134,659,871	W507R	probably damaging	Het
Marf1	C	T	16: 14,142,534	A549T	probably damaging	Het
Mtif3	C	A	5: 146,956,921	V159F	probably benign	Het
Myh6	C	T	14: 54,963,404	R169Q	probably damaging	Het
Ncoa7	T	A	10: 30,647,541	D887V	probably damaging	Het
Obox7	C	T	7: 14,664,388	P76S	probably benign	Het
Olfr1335	A	G	4: 118,809,480	M128T	probably benign	Het
Olfr323	A	T	11: 58,625,668	I126N	probably damaging	Het
Pitpnm2	G	A	5: 124,124,030	A862V	probably damaging	Het
Pkd1	G	C	17: 24,564,703	A162P	probably benign	Het
Plce1	A	G	19: 38,525,184	D309G	possibly damaging	Het
Plk4	T	C	3: 40,805,872	V401A	probably benign	Het
Prdx3	T	C	19: 60,874,512		probably benign	Het
Prrc2c	C	T	1: 162,698,884	V253I	unknown	Het
Ranbp2	T	A	10: 58,480,531	S2358T	probably damaging	Het
Setd2	T	A	9: 110,594,426	V2183E	probably damaging	Het
Sgsm1	T	A	5: 113,285,087	S232C	probably damaging	Het
Skint6	A	T	4: 113,046,815		probably benign	Het
Slc15a2	A	G	16: 36,754,547	I531T	probably benign	Het
Slc36a1	C	T	11: 55,221,994		probably benign	Het
Sorbs2	T	A	8: 45,785,254		probably null	Het
Sorbs2	C	A	8: 45,796,263	D831E	probably damaging	Het
Sptan1	T	C	2: 29,993,696		probably null	Het
Stam	T	C	2: 14,138,141	C336R	probably damaging	Het
Stil	G	T	4: 115,041,298	A1042S	probably damaging	Het
Stxbp5l	T	A	16: 37,142,374	D773V	possibly damaging	Het
Sugct	A	T	13: 17,672,581	L39Q	probably damaging	Het
Tep1	A	G	14: 50,834,065	V2041A	possibly damaging	Het
Tex15	C	T	8: 33,581,502		probably benign	Het
Tlr9	T	G	9: 106,224,965	L485R	possibly damaging	Het
Tmem207	A	G	16: 26,524,829		probably benign	Het
Triml2	T	C	8: 43,185,269		probably benign	Het
Trip6	A	G	5: 137,310,845		probably benign	Het
Vmn1r179	C	T	7: 23,929,167	T261I	possibly damaging	Het
Zfp644	A	T	5: 106,637,003	S559R	possibly damaging	Het

Other mutations in Tspear

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00340:Tspear	APN	10	77873236	missense	probably benign	0.30
IGL01726:Tspear	APN	10	77881287	intron	probably benign
IGL02244:Tspear	APN	10	77852856	unclassified	probably benign
IGL02393:Tspear	APN	10	77836573	missense	probably damaging	1.00
IGL02502:Tspear	APN	10	77852958	intron	probably benign
IGL02653:Tspear	APN	10	77706965	utr 3 prime	probably benign
IGL03345:Tspear	APN	10	77874882	splice site	probably null
R0058:Tspear	UTSW	10	77869631	missense	probably benign	0.07
R0542:Tspear	UTSW	10	77881087	missense	probably benign	0.14
R1384:Tspear	UTSW	10	77866332	missense	probably benign	0.44
R1467:Tspear	UTSW	10	77881192	missense	probably damaging	1.00
R1467:Tspear	UTSW	10	77881192	missense	probably damaging	1.00
R1545:Tspear	UTSW	10	77870419	missense	possibly damaging	0.48
R1625:Tspear	UTSW	10	77870499	missense	probably benign	0.20
R1635:Tspear	UTSW	10	77870419	missense	possibly damaging	0.48
R1636:Tspear	UTSW	10	77870419	missense	possibly damaging	0.48
R1637:Tspear	UTSW	10	77870419	missense	possibly damaging	0.48
R1744:Tspear	UTSW	10	77864884	splice site	probably null
R1749:Tspear	UTSW	10	77869673	missense	probably benign	0.00
R1768:Tspear	UTSW	10	77875116	critical splice donor site	probably null
R1774:Tspear	UTSW	10	77873185	missense	probably benign	0.01
R1791:Tspear	UTSW	10	77870419	missense	possibly damaging	0.48
R1892:Tspear	UTSW	10	77870474	missense	probably benign	0.00
R2014:Tspear	UTSW	10	77875120	splice site	probably benign
R2108:Tspear	UTSW	10	77870419	missense	possibly damaging	0.48
R2248:Tspear	UTSW	10	77873269	missense	probably damaging	1.00
R3038:Tspear	UTSW	10	77886439	nonsense	probably null
R4010:Tspear	UTSW	10	77836476	intron	probably benign
R4661:Tspear	UTSW	10	77866329	missense	probably benign	0.24
R4734:Tspear	UTSW	10	77864695	missense	probably damaging	0.99
R4789:Tspear	UTSW	10	77866365	missense	possibly damaging	0.63
R4804:Tspear	UTSW	10	77776957	splice site	probably null
R4904:Tspear	UTSW	10	77869655	missense	possibly damaging	0.93
R4937:Tspear	UTSW	10	77875043	missense	probably damaging	0.98
R4956:Tspear	UTSW	10	77864767	missense	possibly damaging	0.86
R5590:Tspear	UTSW	10	77870365	missense	probably benign
R6344:Tspear	UTSW	10	77875013	missense	possibly damaging	0.95
R6629:Tspear	UTSW	10	77870509	missense	probably benign	0.08
R7611:Tspear	UTSW	10	77881215	missense	probably benign	0.01
R8507:Tspear	UTSW	10	77875064	missense	probably benign	0.01
R8811:Tspear	UTSW	10	77829629	missense	probably benign	0.08
R8856:Tspear	UTSW	10	77829637	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- AAGGACCATTGGGGCTTAGACACC -3'
(R):5'- GGAGAAAACATCCTGGCTTGCCTG -3'

Sequencing Primer
(F):5'- GGGCTTAGACACCTTGCATAG -3'
(R):5'- ACCTGCTACTGAAGTGGCTC -3'

Posted On

2013-05-09