Incidental Mutation 'R4580:Setd2'
ID343601
Institutional Source Beutler Lab
Gene Symbol Setd2
Ensembl Gene ENSMUSG00000044791
Gene NameSET domain containing 2
Synonyms4921524K10Rik, KMT3A
MMRRC Submission 041599-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.921) question?
Stock #R4580 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location110532597-110618633 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 110574243 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 1984 (T1984I)
Ref Sequence ENSEMBL: ENSMUSP00000116313 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000153838]
Predicted Effect probably benign
Transcript: ENSMUST00000153838
AA Change: T1984I

PolyPhen 2 Score 0.061 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000116313
Gene: ENSMUSG00000044791
AA Change: T1984I

DomainStartEndE-ValueType
low complexity region 19 34 N/A INTRINSIC
low complexity region 156 176 N/A INTRINSIC
low complexity region 185 207 N/A INTRINSIC
low complexity region 297 313 N/A INTRINSIC
low complexity region 392 419 N/A INTRINSIC
low complexity region 795 809 N/A INTRINSIC
low complexity region 867 883 N/A INTRINSIC
low complexity region 1015 1039 N/A INTRINSIC
low complexity region 1066 1077 N/A INTRINSIC
low complexity region 1384 1395 N/A INTRINSIC
AWS 1468 1523 8.39e-30 SMART
SET 1524 1647 3.07e-41 SMART
PostSET 1648 1664 1.27e-5 SMART
Blast:SET 1689 1714 2e-6 BLAST
low complexity region 1884 1909 N/A INTRINSIC
low complexity region 1956 1967 N/A INTRINSIC
coiled coil region 2090 2113 N/A INTRINSIC
low complexity region 2189 2211 N/A INTRINSIC
low complexity region 2248 2265 N/A INTRINSIC
WW 2363 2395 2.1e-11 SMART
Pfam:SRI 2440 2530 6e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196814
Predicted Effect unknown
Transcript: ENSMUST00000197655
AA Change: T120I
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198587
Predicted Effect unknown
Transcript: ENSMUST00000200460
AA Change: T207I
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Huntington's disease (HD), a neurodegenerative disorder characterized by loss of striatal neurons, is caused by an expansion of a polyglutamine tract in the HD protein huntingtin. This gene encodes a protein belonging to a class of huntingtin interacting proteins characterized by WW motifs. This protein is a histone methyltransferase that is specific for lysine-36 of histone H3, and methylation of this residue is associated with active chromatin. This protein also contains a novel transcriptional activation domain and has been found associated with hyperphosphorylated RNA polymerase II. [provided by RefSeq, Aug 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired embryonic vascular remodeling in the embryo proper, yolk sac, and placenta that leads to death around E10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810408A11Rik T C 11: 69,900,411 Y114C probably damaging Het
4932438A13Rik A T 3: 37,030,025 T3864S probably benign Het
Abcc2 T C 19: 43,811,119 S556P probably damaging Het
AI314180 T C 4: 58,840,751 Y669C probably damaging Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Atp6v1g1 A G 4: 63,550,032 N91D probably benign Het
BC005537 G T 13: 24,803,411 A11S probably benign Het
BC049352 G T 9: 45,244,128 probably null Het
Bub1 A C 2: 127,829,676 probably null Het
Ccdc162 T C 10: 41,561,140 T1758A probably benign Het
Cdh15 T C 8: 122,865,158 L594P probably damaging Het
Cobll1 C T 2: 65,151,073 V90I probably benign Het
Cog2 T C 8: 124,545,136 V463A probably benign Het
Cpeb4 T A 11: 31,927,757 probably null Het
Creb5 G A 6: 53,604,534 M172I possibly damaging Het
Cyp4a32 T C 4: 115,602,929 silent Het
Dnah8 T A 17: 30,662,052 S588T probably benign Het
Esd T C 14: 74,742,077 V120A possibly damaging Het
Fbxo5 T C 10: 5,805,255 probably null Het
Gm4922 T C 10: 18,783,684 D430G probably benign Het
Golga4 C A 9: 118,557,259 Q1150K probably benign Het
Grb14 T C 2: 64,953,603 N60S probably benign Het
Grk4 A G 5: 34,660,981 N2S probably damaging Het
Henmt1 T A 3: 108,942,765 S21R probably benign Het
Ifngr2 A G 16: 91,558,018 K113E probably benign Het
Ighv15-2 T A 12: 114,564,970 T15S probably benign Het
Kif24 A G 4: 41,395,287 S529P probably damaging Het
Large2 T C 2: 92,370,612 N51S possibly damaging Het
Lmtk2 A G 5: 144,174,781 E773G possibly damaging Het
Lrfn3 A T 7: 30,360,042 C253S probably damaging Het
Maea T C 5: 33,360,488 V130A possibly damaging Het
March11 A T 15: 26,311,103 I222F probably damaging Het
Mast4 A T 13: 102,737,258 Y1699* probably null Het
Mavs G T 2: 131,240,450 A85S probably damaging Het
Mpzl3 T A 9: 45,068,231 V160E possibly damaging Het
Myh15 T C 16: 49,065,025 S88P possibly damaging Het
Myl2 A T 5: 122,106,738 H157L probably benign Het
Myo9b A G 8: 71,315,135 N284S probably damaging Het
Nphp1 A G 2: 127,768,169 probably null Het
Nrcam T C 12: 44,562,540 probably null Het
Nt5c3b G T 11: 100,433,059 F134L probably damaging Het
Olfr1225 T A 2: 89,171,200 Q4L probably benign Het
Otog A G 7: 46,287,801 R1645G possibly damaging Het
Pask T C 1: 93,322,108 I523M probably benign Het
Pcdhb7 T A 18: 37,342,135 L108Q probably damaging Het
Pdp2 C A 8: 104,594,944 T475K probably damaging Het
Pgbd1 G C 13: 21,428,329 P113A probably benign Het
Plk5 C T 10: 80,360,467 H291Y possibly damaging Het
Pmpca G T 2: 26,393,335 S382I probably damaging Het
Prl3b1 A G 13: 27,249,467 T202A possibly damaging Het
Ptgs2 A T 1: 150,104,094 T317S possibly damaging Het
Ptprc C T 1: 138,071,251 M1020I probably benign Het
Rhbdl3 T C 11: 80,353,645 Y393H probably damaging Het
Sema3e T C 5: 14,233,703 L482P probably damaging Het
Slc17a1 T C 13: 23,887,977 Y393H probably damaging Het
Slc9a3 C T 13: 74,158,886 R377* probably null Het
Slitrk3 A G 3: 73,051,206 S78P probably damaging Het
Specc1 T A 11: 62,219,331 V1054E probably damaging Het
Tbc1d4 T C 14: 101,458,783 T847A probably benign Het
Tcf7l2 G A 19: 55,919,036 G343R probably damaging Het
Tex36 A C 7: 133,587,382 Y154D possibly damaging Het
Topaz1 T A 9: 122,747,515 M57K probably null Het
Trav6-4 T C 14: 53,454,699 Y85H probably damaging Het
Trim30d A G 7: 104,472,558 Y327H possibly damaging Het
Ttn A G 2: 76,951,396 V1056A probably benign Het
Usp32 C A 11: 85,059,127 probably null Het
Vmn1r59 A T 7: 5,454,137 M208K probably damaging Het
Vmn2r25 T C 6: 123,823,023 T787A possibly damaging Het
Vps39 A T 2: 120,339,333 I246N probably benign Het
Xab2 T C 8: 3,610,162 D855G probably damaging Het
Xpc A G 6: 91,500,011 S369P probably benign Het
Ythdc2 T A 18: 44,858,198 C758S possibly damaging Het
Zfp62 A G 11: 49,216,272 I397V possibly damaging Het
Zscan4d A G 7: 11,162,508 S312P probably benign Het
Other mutations in Setd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00722:Setd2 APN 9 110551136 missense possibly damaging 0.94
IGL01023:Setd2 APN 9 110547513 nonsense probably null
IGL01063:Setd2 APN 9 110573673 missense probably damaging 1.00
IGL01745:Setd2 APN 9 110594711 missense probably damaging 0.99
IGL01911:Setd2 APN 9 110617431 splice site probably null
IGL01955:Setd2 APN 9 110549318 missense probably benign 0.38
IGL02023:Setd2 APN 9 110594636 missense probably benign 0.06
IGL02080:Setd2 APN 9 110547450 splice site probably null
IGL02412:Setd2 APN 9 110550774 missense probably benign 0.00
IGL02519:Setd2 APN 9 110553116 missense probably damaging 0.97
IGL02631:Setd2 APN 9 110550576 missense possibly damaging 0.80
IGL02754:Setd2 APN 9 110550056 missense possibly damaging 0.77
IGL02828:Setd2 APN 9 110561214 missense probably benign 0.31
IGL03033:Setd2 APN 9 110551275 missense possibly damaging 0.96
IGL03140:Setd2 APN 9 110614952 critical splice donor site probably null
IGL03378:Setd2 APN 9 110553152 missense unknown
American_samoa UTSW 9 110567758 nonsense probably null
slingshot UTSW 9 110549507 missense probably benign 0.00
P0028:Setd2 UTSW 9 110573954 missense probably benign 0.00
PIT4544001:Setd2 UTSW 9 110551164 missense probably damaging 1.00
R0058:Setd2 UTSW 9 110594426 missense probably damaging 0.98
R0058:Setd2 UTSW 9 110594426 missense probably damaging 0.98
R0167:Setd2 UTSW 9 110573782 missense probably damaging 1.00
R0408:Setd2 UTSW 9 110594242 missense probably damaging 1.00
R0452:Setd2 UTSW 9 110553100 splice site probably null
R0541:Setd2 UTSW 9 110573673 missense probably damaging 1.00
R0947:Setd2 UTSW 9 110548511 missense possibly damaging 0.87
R1249:Setd2 UTSW 9 110573880 missense probably damaging 0.99
R1294:Setd2 UTSW 9 110549507 missense probably benign 0.00
R1518:Setd2 UTSW 9 110602238 missense probably damaging 0.98
R1585:Setd2 UTSW 9 110551396 missense unknown
R1647:Setd2 UTSW 9 110549864 missense probably benign 0.12
R1649:Setd2 UTSW 9 110549864 missense probably benign 0.12
R1651:Setd2 UTSW 9 110549864 missense probably benign 0.12
R1652:Setd2 UTSW 9 110549864 missense probably benign 0.12
R1673:Setd2 UTSW 9 110604180 missense probably damaging 0.97
R1703:Setd2 UTSW 9 110549864 missense probably benign 0.12
R1706:Setd2 UTSW 9 110549864 missense probably benign 0.12
R1709:Setd2 UTSW 9 110549857 missense probably benign 0.00
R1752:Setd2 UTSW 9 110594605 missense probably damaging 1.00
R1796:Setd2 UTSW 9 110550345 missense probably benign 0.01
R1796:Setd2 UTSW 9 110617816 critical splice acceptor site probably null
R1812:Setd2 UTSW 9 110550102 missense probably damaging 0.99
R1884:Setd2 UTSW 9 110556418 critical splice donor site probably null
R2024:Setd2 UTSW 9 110549133 missense possibly damaging 0.65
R2051:Setd2 UTSW 9 110550890 missense probably benign
R2117:Setd2 UTSW 9 110604144 frame shift probably null
R2120:Setd2 UTSW 9 110549864 missense probably benign 0.12
R2124:Setd2 UTSW 9 110549864 missense probably benign 0.12
R2172:Setd2 UTSW 9 110549844 missense probably benign 0.10
R2179:Setd2 UTSW 9 110594688 nonsense probably null
R2262:Setd2 UTSW 9 110561243 intron probably benign
R2411:Setd2 UTSW 9 110550429 missense possibly damaging 0.46
R2413:Setd2 UTSW 9 110547504 missense probably damaging 1.00
R2419:Setd2 UTSW 9 110548997 missense possibly damaging 0.48
R2424:Setd2 UTSW 9 110617522 missense probably benign 0.37
R3757:Setd2 UTSW 9 110573685 missense probably damaging 0.99
R3765:Setd2 UTSW 9 110594246 missense probably damaging 1.00
R3796:Setd2 UTSW 9 110549571 missense probably benign 0.00
R3797:Setd2 UTSW 9 110549571 missense probably benign 0.00
R3799:Setd2 UTSW 9 110549571 missense probably benign 0.00
R3899:Setd2 UTSW 9 110592518 missense probably damaging 1.00
R3900:Setd2 UTSW 9 110592518 missense probably damaging 1.00
R3913:Setd2 UTSW 9 110551046 missense probably damaging 0.99
R4010:Setd2 UTSW 9 110599195 missense probably null 1.00
R4614:Setd2 UTSW 9 110569813 critical splice donor site probably null
R4651:Setd2 UTSW 9 110594132 missense possibly damaging 0.53
R4652:Setd2 UTSW 9 110594132 missense possibly damaging 0.53
R4855:Setd2 UTSW 9 110571954 missense probably benign 0.02
R4970:Setd2 UTSW 9 110548158 missense probably benign 0.28
R5112:Setd2 UTSW 9 110548158 missense probably benign 0.28
R5123:Setd2 UTSW 9 110617527 missense possibly damaging 0.76
R5140:Setd2 UTSW 9 110551129 missense probably benign 0.00
R5202:Setd2 UTSW 9 110551230 missense probably damaging 1.00
R5290:Setd2 UTSW 9 110617831 missense probably damaging 1.00
R5560:Setd2 UTSW 9 110549839 nonsense probably null
R5604:Setd2 UTSW 9 110604216 missense probably damaging 0.99
R5678:Setd2 UTSW 9 110602186 missense probably damaging 0.99
R5708:Setd2 UTSW 9 110548823 missense possibly damaging 0.59
R5763:Setd2 UTSW 9 110556275 splice site probably null
R5814:Setd2 UTSW 9 110567758 nonsense probably null
R5924:Setd2 UTSW 9 110574044 missense probably benign 0.23
R6244:Setd2 UTSW 9 110548665 missense probably damaging 1.00
R6313:Setd2 UTSW 9 110556366 missense unknown
R6431:Setd2 UTSW 9 110550385 missense possibly damaging 0.65
R6526:Setd2 UTSW 9 110532717 missense probably benign 0.33
R6579:Setd2 UTSW 9 110549778 missense possibly damaging 0.87
R6996:Setd2 UTSW 9 110550572 missense probably damaging 0.99
R7012:Setd2 UTSW 9 110547683 missense probably damaging 0.97
R7105:Setd2 UTSW 9 110548260 missense probably damaging 1.00
R7134:Setd2 UTSW 9 110548797 missense possibly damaging 0.87
R7222:Setd2 UTSW 9 110551462 missense
R7359:Setd2 UTSW 9 110562944 missense
R7492:Setd2 UTSW 9 110594632 missense
R7643:Setd2 UTSW 9 110567840 splice site probably null
R7869:Setd2 UTSW 9 110550014 nonsense probably null
R7903:Setd2 UTSW 9 110617837 missense
R8004:Setd2 UTSW 9 110592545 missense
R8017:Setd2 UTSW 9 110602187 missense
R8019:Setd2 UTSW 9 110602187 missense
R8366:Setd2 UTSW 9 110548748 missense probably damaging 1.00
R8460:Setd2 UTSW 9 110594270 missense
RF009:Setd2 UTSW 9 110550711 missense probably damaging 1.00
Z1176:Setd2 UTSW 9 110532726 missense possibly damaging 0.85
Z1176:Setd2 UTSW 9 110547275 missense probably damaging 0.99
Z1176:Setd2 UTSW 9 110547579 missense probably damaging 0.97
Z1177:Setd2 UTSW 9 110547476 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCCAAAGTTGAGAGTGAAGCC -3'
(R):5'- CTGGAGACACATCTATCACAAACTG -3'

Sequencing Primer
(F):5'- GAAGTCAGTAAGTTACCCACATCTG -3'
(R):5'- TAGGTTACAGCACACGGA -3'
Posted On2015-09-24